NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>119) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kunenkov-effective.pdf

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>19) - foroff.phys.msu.ru/ )

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>10) - www.dubinushka.ru/ )

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>46) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Geometric methods in optimal control theory | Department: General Problems of

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.  ...

Еще в разделе: (Показать все результаты (>3) - siberian-lang.srcc.msu.ru/ )

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблем  и для их преподавания. ...

Еще в разделе: (Показать все результаты (>4) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>58) - chaos.phys.msu.ru/ )

• Links

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1738) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>23) - dbserv.sinp.msu.ru/ )

• The Other BAFIZ Pages

... Home Resources Publications Agricultural markets and global state of food.. ... Since the beginning of the 2000s the situation in the global agro-food market is characterized by the upward trend against the background of price volatility. The increase in consumption in developing countries, especially China and India, along with rising incomes and a shift in demand for more nutritious foods are some of the factors that determine the long-term increase in demand for agricultural commodities. ...

Еще в разделе: (Показать все результаты (>35) - ecfs.msu.ru/ )

• Resources | ECFS
• News | ECFS
• Archive news | ECFS

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>7) - lmmqsp.sinp.msu.ru/ )

VOLUME 86, NUMBER 20 PHYS ICAL REVIEW LETTERS (a) 3200 2400 1600 14 M (b) 2000 1600 1200 800 400 AY 2001 Comment on "Dispersion-Independent High-Visibility Quantum Interference in Ultrafast Parametric Down-Conversion" Recently AtatЭre et al. claimed to "recover" highvisibility quantum interference in femtosecond pulse pumped type-II spontaneous parametric down-conversion (SPDC ) using neither spectral postselection nor a thin nonlinear crystal [1]. ... This is what AtatЭre et al. observed in Ref. ...

Еще в разделе: (Показать все результаты (>56) - qi.phys.msu.ru/ )

. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.

135. http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_2.pdf

136. http://www.fbm.msu.ru/upload/news/2012/12-05/progr.doc

137. http://fpga.parallel.ru/papers/gudkov.pdf

138. Вычислительные библиотеки, использующие ГПУ

139. Brief CompHep Installation Instruction

140. NEW MSU Graduates Club notice board