... 2009 J. Opt. ... Opt. ... Coefficients a3 jx (z ), a3 jy (z ) ( j = x , y ), describing the quantities of the first order on the divergence angle of the beam in (7) are more complex, than a3x , y : a a a a my mx 2cos m emy = n m cos m + cos m 2cos m cos m emx = n m cos m + cos m a 3 jx (z ) = в + 4 cos 3 (S (z ) Ї e3 ) 4(S Ї e3 )g - r cos 3 + n 3 cos 3 k3 cos 3 ( j) (0) ( j) (z ) tan 3 - tan 3 tan 3 - n 2 tan 3 3 + sin2 3 (n 3 cos 3 + ... A 45 259ґ60 [21] Porras M A 1996 Opt. ...

Еще в разделе: (Показать все результаты (>122) - ilc.phys.msu.ru/ )

• Multichannel spectroscopy
• CCD detectors
• Diagnostic appliances and setups for femtosecond spectroscopy

... More Reports . ... Vocal repertoire in the Dhole Cuon alpinus in captivity // In: Canid Biology and Conservation, An International Conference, Oxford. Three independent structural components form the dhole vocal repertoire: the low tonal, the high tonal, and the pulsed one. On the base of the occurrence of the components the dhole vocal repertoire was represented as consisting of three vocal classes with eleven call types. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>52) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

• Our publications

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Abstracts . Abstract submission form . ... Abstract should not exceed 2 pages . ... automatic numbering (for equations, theorems, etc.), . ... Abstracts will be parsed automatically to compile the book of abstracts. ... TeX-file with the abstract should be submitted online through the abstract submission form . ...

Еще в разделе: (Показать все результаты (>36) - pont2008.cmc.msu.ru/ )

• Preliminary List of Plenary Talks International Conference Differential
• Ожидаемые пленарные доклады Международная конференция Дифференциальные
• Second Announcement International Conference Differential Equations and

... please find attached the second announcement about the VII Moscow International Conference on Operations Research (ORM2013) in October, 15-19, 2013 in Moscow, Russia. You are welcome to submit extended abstracts of your talks to 2013ORM@gmail.com. An extended abstract should be presented as a LaTex file in English language according to the attached template, and its volume should be three pages (or little less). Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>23) - io.cmc.msu.ru/ )

... 40 (2007) 12033ґ12042 JOURNA L OF PHYSICS A: MAT HEMATICAL AND THEORETICAL doi:10.1088/1751-8113/40/40/002 Generalization of the DLA process with different immiscible components by time-scale coarse graining EBPostnikov1, A B Ryabov2 and A Loskutov2 1 Kursk State University ... September 2007 Online at stacks.iop.org/JPhysA/40/12033 Abstract In the framework of the mean-field approximation we propose a new approach to the description of the growth of ...

Еще в разделе: (Показать все результаты (>66) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Astron_lett1.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JSPstadium(t).pdf
• http://chaos.phys.msu.ru/loskutov/PDF/TDB_Loskutov_Leonel.pdf