... Программа на сентябрь 2008 г. 24 сентября. H. Wakaki (Hiroshima University). An error bound for Box's chi-square type asymptotic expansion of Wilks' Lambda distribution. Abstract. An error bound for the Box's chi-square type asymptotic expansion of Wilks' Lambda distribution is derived. It is compared with an error bound for the high-dimensional Edgeworth expansion. ... Convergence of Multinomial Goodness-of-fit Statistics to Chi-square Distribution. ...

Еще в разделе: (Показать все результаты (>67) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk_18_6.html
• http://new.math.msu.su/department/probab/bsk11_13.htm
• http://new.math.msu.su/department/probab/bsk10_14.htm

Guide to Market Research and Analysis Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4013 Summary Successful businesses have extensive knowledge about their customers and their competitors. ... Market Analysis Who is your customer? ... Product or service focus must be the customer. ... The information will assist in determining business size (output requirements), distribution channels, pricing, promotion strategy and other marketing decisions. ...

Еще в разделе: (Показать все результаты (>11) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/marketingplanoutline.doc

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>2) - oc.cs.msu.su/ )

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>9) - www.eng.math.msu.su/ )

List of Publications . ... Odoulov S,Tarabrova T, Shumelyuk S, Naumova II, Chaplina TO: Photorefractive response of bulk periodically poled LiNbO 3 :Y:Fe at high and low spatial frequencies. ... Evlanova N.F., Naumova I.I., Chaplina T.O., Blokhin S.A. and Lavrishchev S.V. Periodically poled Y:LiNbO 3 single crystal: impurity distribution and domain wall location, Journal of Crystal Growth, Vol. 223, ? 1-2, pp 156-160 (2001). ... Phys. Rev. Lett., 86, pp 4021-402 (2001). ...

Еще в разделе: (Показать все результаты (>2) - newcryst.phys.msu.ru/ )

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>7) - bioinf.fbb.msu.ru/ )

• SDPlight
• Algorithm
• SDPpred

Lomonosov project . ... Personnel . ... Affiliation D.V. Skobeltsyn Institute of Nuclear Physics of M.V. Lomonosov Moscow State University . ... Phone 7 495 939 1818 . ... Phone 7 495 939 5731 . ... Phone 7 495 939 1010 . Fax 7 495 939 0896 . ... Affiliation Moscow State University, Sternberg Astronomical Institute . ... Fax 7 495 939 5063 . ... Institute for Biomedical Problems of the Russian Academy of Sciences, Skobeltsyn Institute of Nuclear Physics of Moscow State University. ...

Еще в разделе: (Показать все результаты (>22) - lomonosov.sinp.msu.ru/ )

• Collaboration | Университетский спутник "Ломоносов"

... О UNИX . ... Rpath . Неизменяемая страница . ... Нетривиальные программы имеют свойство иметь зависимости на библиотеки. ... Более настойчивые таки открывают справку по линкеру и узнают про runtime library search path. Добавив магические опции -Wl,-rpath= pwd (?Кто вообще придумал этот синтаксис??), приложение с библиотекой таки удается запустить. ... Сборка с системными библиотеками ? ... eSyr/BuildSystemsCoursePlan/Rpath (последним исправлял пользователь eSyr 2016-02-06 09:17:19) . ...

Еще в разделе: (Показать все результаты (>56) - uneex.mithril.cs.msu.su/ )

• HelpOnUpdating - UNИX
• Meetings/Murray - UNИX

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

In order to promote a better understanding of American life and institutions, the Bureau of Educational and Cultural Affairs (BECA) of the U.S. Department of State is offering six-week academic programs aimed at improving U.S. studies curricula abroad. Each Fulbright American Studies Institute focuses on a particular discipline of American studies or on a special topic within a discipline. ... Contemporary American Literature" . ... U.S. Political Economy and the Global Economic System" . ...

Еще в разделе: (Показать все результаты (>134) - www.prof.msu.ru/ )

• Institute of Civilization
• Statement of purpose
• The conference "Human Rights in Russia: the past and the present"

... PhD student needed in the Institute of Physical Chemistry in Warsaw, Poland for a study involving mostly calculations and NMR measurements of strained hydrocarbons with unusual spatial structure. ... As can be seen in the webpage, the group is also involved in studies in supramolecular chemistry and, if interested, the student could also take part in this research. ... The entrance exam is based on "Physical Chemistry" by Atkins. ...

Еще в разделе: (Показать все результаты (>19) - www.chemport.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... 1984: Department of Structural and Applied Linguistics, Philological Faculty, Moscow State University; M.A. earned in June 1984. ... 2003, Habilitation report: Analiz diskursa v kognitivnoj perspektive (Discourse analysis in a cognitive perspective) [ pdf ]. Institute of Linguistics RAN. 90 pp.. ... Cognitive Lingustics Association (since 1997). ... Cognitive Linguistics (Berlin, Mouton de Gruyter), 1997 ? ... Popularization of the advances in linguistics and cognitive science on Russian TV. ...

Еще в разделе: (Показать все результаты (>249) - www.philol.msu.ru/ )

• Московское типологическое общество :: МГУ :: Филфак :: ОТиПЛ
• Second International Linguistic Olympiad (2004) :: МГУ :: Филфак :: ОТиПЛ

... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...

Еще в разделе: (Показать все результаты (>36) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |
• Лаборатория химии и физики полупроводниковых и сенсорных материалов

Quantum Chemistry in Studies of Elementary Stages of Enzymatic Catalysis Alexander Nemukhin Department of Chemistry M.V. Lomonosov Moscow State University Russian Federation N.M. Emanuel Institute of Biochemical Physics Russian Academy of Sciences The aim is to study mechanisms of chemical reactions in complex molecular environment by considering J. Phys. Chem. ... Chem., ... Modeling, 2005, 11, 503 Grigorenko B., Rogov A., Nemukhin A. // J. Phys. Chem. ...

Еще в разделе: (Показать все результаты (>11) - lcc.chem.msu.ru/ )

Cell Biology International. ... Drugs, time of treatment Control active centriole inactive centriole DNP , 30min active centriole inactive centriole active centriole inactive centriole active centriole inactive centriole active centriole inactive centriole Short MTs with Long MTs with Short MTs with Long MTs with Total number free ends attached end attached end free ends of ... 50.4 ± 3.1 MTs radiated from the centrosome in cells treated with DNP for 30 min. ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

• Alieva Irina

... Полная версия этой страницы: STATISTICA (Excel устроит) . Студенческий форум Физфака МГУ > Наука физика > Есть проблема . Free Researcher . 16.1.2007, 15:44 . ... лично меня бы устроило написать тупую прогу, которая все посчитает и запишет в файл. ... Там есть такая функция СЧЕТЕСЛИ, два аргумента - столбец, в котором считать и критерий. ... СЧЕТЕСЛИ(C1:C14;">A1")-СЧЕТЕСЛИ(C1:C14;"<B1")+СЧЕТЕСЛИ(D1:D14;">A1")-СЧЕТЕСЛИ(D1:D14;"<B1") . ...

Еще в разделе: (Показать все результаты (>246) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Barclays Capital 2009

... Eagle Broadband Picks Terremark NAP . Eagle Broadband Picks Terremark NAPEagle says it selected Terremark NAP of the Americas because of its secure and reliable connection to customers throughout the US. The NAP of the Americas will serve as the central distribution hub for Eagle IPTV solution. this industry trend continues to get traction, we are delighted to welcome Eagle Broadband as one of the first IPTV distributors to our facility, says Manuel Medina, chairman and CEO of Terremark. ...

Еще в разделе: (Показать все результаты (>39) - elana.sinp.msu.ru/ )

... Hyperfine interactions and local magnetic states in magnetoordered alloys and compounds. ... P.N Stetsenko, professor, Dr. of Sci. V.V.Surikov, professor, Dr. of Sci. S.D. Antipov, docent, Ph.D. Ju.I. Avksentjev, docent, Ph.D. G.V.Smirnitskaja, Senior Scientific, Dr. of Sci. ... Institute of General Physics RAN . Kazan State University . ... Intensive investigations of new classes of magnetic materials - magnetic superlattices and half-metallic ferromagnets were performed. ...

Еще в разделе: (Показать все результаты (>17) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Laboratory of Ferroelectricity

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )