... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin’s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>13) - lcl.srcc.msu.ru/ )

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Conference Venue . Conference Opening ceremony will take place on Tuesday, June 17 at 13:00 in the MSU Library Building . ... On other conference days registration will be possible in the room 706 of the 2-nd Educational Building. ...

Еще в разделе: (Показать все результаты (>8) - pont2008.cmc.msu.ru/ )

• Timetable of plenary lectures Международная конференция Дифференциальные

... Юрий (admin) Новости R , Statistics One , используем R , статистика 2 Comments . Statistics One, Assignment One #Read data, plot histograms, get descriptive library(psych) #Read the data into a dataframe called working_memory working_memory . Как повысить ТИЦ и PR от 100 рублей Statistics One, Lecture 3, example script . ... Дайджест психологических исследований . ЖЖ-сообщество ?RU_SPSS? ... Статистика блога . ... R-советы: Экономим время и место на диске путем сжатия файла данных . ...

Еще в разделе: (Показать все результаты (>25) - tukachev.flogiston.ru/ )

• Statistics One, Lecture 3, example script
• Statistics 1, Assignment 2
• Tag: Statistics One

Alexander M. Kuznetsov . ... Sasha Kuznetsov entered a famous Theoretical Department of the Institute of Electrochemistry AN USSR in 1961, and joined Prof. R.R.Dogonadze group, They pioneered the quantum mechanical theory of electron transfer in solutions, which now became a general theory of in chemical, electrochemical and biological systems. ... Concludingly A.M. Kuznetsov is one of the pioneers and creators of quantum mechanical theory of charge transfer processes in condensed media. ...

Еще в разделе: (Показать все результаты (>56) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

... Local Nonlinear and Parametric Effects for Non-Bonded Contacts in Solids . ... A strongly nonlinear behavior of a closed non-bonded contact area in solids for a harmonic drive is associated with two major mechanisms: the lack of symmetry for compression-extension deformations across the interface ("clapping" mechanism) and the nonlinearity of "slide-and-stick" forces between the surfaces in contact (hysteresis mechanism). ...

Еще в разделе: (Показать все результаты (>79) - acs366.phys.msu.su/ )

• Abstract (Invited)

Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...

Еще в разделе: (Показать все результаты (>39) - geophys.geol.msu.ru/ )

• Azimuthal resistivity survey

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>16) - imk.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>7) - mouse.belozersky.msu.ru/ )

• PLANdbAffy: probe-level annotation database for Affymetrix expression

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>3) - www.students.chemport.ru/ )

... Published: 30 October 2014 . Science Festival took place in Moscow on October 10-12 2014 . Science Festival include more than 80 different areas. ... Engineering Physics Laboratory demonstrated different robots: balancing robot, LIDAR area scanner, jumping robot Z-Hopper and speech depersonalizer. We also entertain visitors with liquid nitrogen. Everybody could pour it on hands, breathe it and look at the frozen things in nitrogen. ...

Еще в разделе: (Показать все результаты (>15) - engineering.phys.msu.ru/ )

• Science Festival 2013
• Introduction to Linux
• Science Festival 2014

... michael kors outlet uk . the north face outlet . ... ray ban outlet uk . longchamp outlet . moncler outlet uk . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>50) - elana.sinp.msu.ru/ )

• cheap moncler you may have the funds needed in another account such as a

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>7) - hcs.cmc.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

. Jump to: navigation , search . You must log in to view other pages. Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:Contributions/93.180.27.85 " . Special page . Log in . Новости, главное . Страница курса . Сдача заданий . 1-й семестр 2015 г. Материалы по системе ejudge . Планы прошлых лет . Участники . Recent changes . Special pages . Privacy policy . About MediaWiki . Disclaimers

Еще в разделе: (Показать все результаты (>5) - algcourse.cs.msu.su/ )

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>2) - discours.philol.msu.ru/ )

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1617) - fgp.msu.ru/ )

• featured post п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...

Еще в разделе: (Показать все результаты (>8) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom2_2013.pdf

... Air pollution induced changes in pine needle chemistry were observed at sample sites in the surroundings of the Pechenganikel smelter. ... Close to the pollution source needles were enriched in Ni and Cu by needle age. Correlation and principal component analyses show that changes in the element composition of pine needles depended on air pollution and on natural factors as well. The contribution from air pollution increased with needle age. ...

Еще в разделе: (Показать все результаты (>34) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Response of pine forests to long-term air pollution at the
• CRITICAL LOADS OF ACID DEPOSITION FOR FORESTS
• MULTIVARIATE ANALYSIS OF SOIL CHEMICAL PROPERTIES

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )