Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>126) - ffl.msu.ru/ )

• Наш факультет
• About Us

... About Journal | ... The Editorial team's publication decisions are made based on the data reliability and the scientific value of the work despite the race, gender, nationality, citizenship, social position, religious or political views of the Authors. ... The Reviewer performs the impartial expertise of Author's materials. ... The Reviewer must notify the editorial team on any interest conflict with the Author, with the request for excluding him from the reviewing of the given manuscript. ...

Еще в разделе: (Показать все результаты (>40) - www.socio.msu.ru/ )

Towards celestial sources above 1 THz with a heterodyne receiver based on a hot-electron bolometer mixer Sergey Ryabchun, Ivan Tretyakov, Matvey Finkel, Natalia Kaurova, Boris Voronov and Gregory Gol'tsman HOT-ELECTRON BOLOMETER (HEB) MIXER Scient ific and Educatio nal Radiophysics Center Mo scow State Pedago gical University Mo scow, Russia FIRST GROUND-BASED OBSERVATION WITH HEB MIXERS BEYOND 1 THz Submillimeter Telescope ...

Еще в разделе: (Показать все результаты (>26) - site2010.sai.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

... Phys., 6, 313, 1955); his study also was base on the magnetometers data. The first instant auroral ring model based on experimental all-sky camera data was presented by Olga Khorosheva in 1961. ... But it was Olga who reconstructed first continuous auroral image and firmly defended the auroral ring model. ... Имя Ольги Хорошевой не было известно за рубежом, она не участвовала в международных конференциях, и модель "колечка Хорошевой" не получила широкого распространения. ...

Еще в разделе: (Показать все результаты (>229) - www.kosmofizika.ru/ )

• Frequently Seen Space/Astronomy Acronyms
• CRRES 560

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. February 7, 1998 . COBE Hotspots: The Oldest Structures Known . ... After computer processing to remove contributions from nearby objects and the effects of the earth's motion , the map shows temperature variations in the early Universe as red "spots". These spots are the oldest, most distant structures known. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>20) - www.arcetri.astro.it/ )

• APOD: October 2, 1999 - Phi Persei: Double Star

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>4) - www.edst.msu.ru/ )

... M.S. in Physics, entitled "Hyper-Rayleigh Scattering On Third and Second Harmonics In Silver Island Films", Moscow State University, 2003 with honor. ... Didenko N.V., Kim E.M., Muzychenko D.A., Nikulin A.A., and Aktsipetrov O.A. "Structural studies of silver island films probed by hyper-Rayleigh scattering and atomic force microscopy", Surf. ... Kim E.M., Elovikov S.S., Aktsipetrov O.A., "Surface enhanced third harmonic generation in silver island films", Proceeding's of SPIE 48, Vol 5222A, 2003. ...

Еще в разделе: (Показать все результаты (>37) - shg.phys.msu.ru/ )

• CURRICULUM VITAE
• Intro

pic] [pic] AGREEMENT on cooperation between the Network of Universities from the Capitals of Europe (UNICA) and All-Russia Non-Government Organization The Russian Rectors ' Union (RRU) Based upon understanding of the priority role of Higher Education Institutions in global processes of forming knowledge-based world economy and society; the fundamental principle of university education - studies, science and ... of the Russian Rectors' Union, |of the Network of Universities | ...

Еще в разделе: (Показать все результаты (>41) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/88.doc
• http://www.rsr-online.ru/doc/norm/354.doc
• http://www.rsr-online.ru/doc/norm/541.pdf

. Наземные станции . Оборудование . Текст о наземных спутниковых станциях, которые использует сеть Радио-МГУ, будет здесь несколько позже.

Еще в разделе: (Показать все результаты (>3) - www.radio-msu.net/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

• Department of the Composites Mechanics

... Basics of electrocatalysis , mechanisms of electrocatalytic processes and electron transfer elementary act in heterogeneous systems are accented, including experimental verification of modern quantum-mechanical theory of elementary act , molecular modeling (in cooperation with Kazan State Technological University), experiments with in situ newly generated surfaces of metals ... O.A.Petrii, G.A.Tsirlina, Electrode potentials . ... Acta 2002, v.47, p.2775. ... B 2004, v. 108, p. 17096. ...

Еще в разделе: (Показать все результаты (>75) - electr003.chem.msu.ru/ )

• Electrocatalytic effects in gas sensors based on low-temperature superprotonics
• Evgeny V. Antipov:CV

WRB (World Reference Base for Soil Resources), , - , . WRB; ; : : , . ... 1970. Lecture Notes on the Major Soils of the World. ... World Soils. 1:15 000 000.. ... FA/UNESCO Soil Map of the World at 1:5000 000.Unesco, Paris, 1971-1975. ... Soil Atlas of Europe. ... Soil Bureau. 2005 Map of Human-induced Soil Degradation. Scale1:10M. ...

Еще в разделе: (Показать все результаты (>282) - www.geogr.msu.ru/ )

• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• CONTENTS ?2 - 2009
• "Пластовые льды"

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>3) - depni.sinp.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>6) - cellbiol.genebee.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

138. Магистратура ВМК МГУ - подготовка ERP-программистов, консультантов SAP

139. http://angel.cs.msu.su/~oxana/image_processing/papers/2008-i07-056.pdf

140. archives