... 100 10 1 0.1 . ... 350 300 250 200 150 100 50 0 ( ) 318 95.1 0.816 1 0.107 0.055 14.6 17.2 0.0017 q q ( ) ( 6o) q , q ~ 4.7 . ... dM F = -G M dM r 2 r dA = F dr = R R =G M dM R(M) M M= 4 3 R 3 M 3 R = 4 1/ 3 M 1/ 3 4 A = G 3 1/ 3 0 M M 2/3 dM 4 A = G 3 1/ 3 1/ 3 3 5 5/3 G = 6.67 10 -11 /( ) 3 2 3 24 = 5518 / 4 A = G 3 1/ 3 M = 5.978 10 1/ 3 3 5 32 M 5/3 A 2.24 10 G = 6.67 10 -11 /( ) 3 2 3 24 : 6.12·106/ = 5518 / 4 A = G 3 1/ 3 M = 5.978 10 1/ 3 3 5 7 M 5/3 A / M 3.9 10 / ~2.24·1032 30000 oC 100 . ...

Еще в разделе: (Показать все результаты (>2) - geonew.phys.msu.ru/ )

... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...

Еще в разделе: (Показать все результаты (>6) - geophys.srcc.msu.ru/ )

W elcome to LHE guests page . ... 1) Enter metro station, buy a metro ticket in the ticket-office if You have not it yet. ... You will find a table with the prices near the ticket-office. ... 1) Buy a bus ticket in a kiosk near the bus stop if You have not it yet. ... It is possible to buy a ticket for 1 trip from the bus driver (28 rub). 2) Enter a bus through the front door, stick your ticket into a machine near the turnstile and take it. ... You can find more information on this site . ...

Еще в разделе: (Показать все результаты (>3) - lhe.sinp.msu.ru/ )

... Структура факультета . ... Международное сотрудничество . ... История юридического факультета . ... 20?26 июля 2014 г. в Вене (Австрия) состоялся XIX международный конгресс сравнительного права (XIX th International Congress of Comparative Law). ... интернационализация юридического образования; . права человека и частное право; . ... В работе конгресса принял участие ассистент кафедры гражданского права юридического факультета МГУ М.Л. Башкатов. ... Юридический факультет МГУ, 2009. ...

Еще в разделе: (Показать все результаты (>2) - old.law.msu.ru/ )

• Юридический факультет МГУ

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>10) - hcs.cmc.msu.ru/ )

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

153. Главная страница

154. http://mph.cs.msu.ru/mph/arh/blank/month-report.doc

155. http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-09-FPM-Diffuser.pdf

156. http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc

157. Институт мировой культуры МГУ. А. М. Лидов

158. Кафедра физики Земли Физического Факультета Московского Государственного

159. http://www.geol.msu.ru/vestnik/spisok_vak.pdf

160. Curriculum Vitae of Dr Alexei A