... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
... The "Mulliken" AMMs up to the fourth order were calculated within the scheme developed by Saunders et al. [13] using the B3LYP, Perdew-Wang (PW91), and Perdew-BurkeErnzerhof (PBE) functionals with the 6-21G** basis set (for shortness, noted below basis set 3 or BS3) for all ALPOs, while the ATN and ATO structures were also considered at other levels as STO-3G (BS1), 3-21G (BS2), and 8-511G*(Al)/8-521G*(P)/8411G*(O) (BS4) for comparison. ... No EP convergence with the basis set was observed. ...
... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Wavelet Analysis of Fine-Scale Structures in the Saturnian B and C Rings Using Data from the Cassini Spacecraft E. B. Postnikova and A. Yu. ... These factors are especially important for the fine-scale structure of Saturn's A ring. ... The efficiency of the wavelet transform with a simple Morlet wavelet basis in solving this task was successfully demonstrated by our study of resonance structures in Saturn's A ring [10]. ...
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
Press release 20 July 2011 New funding for early-career top researchers from anywhere in the world: 730 million for new "ERC Starting Grant" call The European Research Council (ERC) today opens its fifth call for proposals for the "ERC Starting Grants", targeted at early-career top researchers of any nationality, working - or moving to work - in host institutions in Europe. ... Last year, the success rate of Starting Grants proposals was around 15%. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... Is it necessary to do the beam weaker? ... Q: If the mixture of powders consists of both isotropic and anisotropic particles, is it possible to estimate the ratio of isotropic and anisotropic parts? If I understand the question correctly, one asks, if one has a fraction of oriented anisotropic particles and a fraction of the disoriented anisotrpic particles (i.e. one has somewhat partial texture in the powder sample), then is it possible to find out these fractions? ...
Monitoring of chloride and chloride-selective ion channels activity using genetically encoded fluorescent sensors. ... Quinoline-based fluorescent dyes sensitive to Cl have low biological toxicity, relatively good sensitivity and selectivity to Cl and rapid response to changes in Cl. ... Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
... Начало www.99ru.ru Искусство и культура Другие виды искусства 1607 . ... Художественные . ... Этнография Фольклор . ... Введите код товара из каталога. автор Альбом . Рисунки в старинных манускриптах Illumination in a manuscript of Stj?rn . ... In an Icelandic manuscript from Stj?rn there is a depiction of a man in an orange tunic. ... Source: "Illumination in a manuscript from Stj?rn", by Selma J?nsd?ttir, colour plate IV and VI (Submitted by Eva). звоните по тел. 8926-6667253 и договоримся. ...
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
PALAEOPATHOLOGY IN RUSSIA: HISTORICAL BACKGROUND A. Buzhilova Institute and Museum of Anthropology, MSU, Moscow В статье предлагается версия хронологических этапов становления палеопатологии в России. Особое внимание уделяется первым работам в области палеопатологии, представленным основателями физической антропологии в России - К.М. Бэром и Д.Н. Анучиным. Рассматривается вклад основателя русской школы палеопатологии Д.Г. Рохлина. ... Бужилова А.П. Homo sapiens: история болезни. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/091/3.pdf -- 179.0 Кб -- 19.08.2010
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/091/3.pdf -- 179.0 Кб -- 19.08.2010 Похожие документы
February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005 Похожие документы
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
ISSN 1560-3547, Regular and Chaotic Dynamics, 2007, Vol. ... RESEARCH ARTICLES Interaction between Kirchhoff Vortices and Point Vortices in an Ideal Fluid A. V. Borisov* and I. S. Mamaev ** Institute of Computer Science, Udmurt State University, Universitetskaya ul. 1, 426034 Izhevsk, Russia Received March 1, 2005; accepted January 14, 2006 Abstract--We consider the interaction of two vortex patches (elliptic Kirchhoff vortices) which move in an unbounded volume of an ideal incompressible fluid. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/099/147-interaction-between-kirchhoff-vortices-and-point-vortices-in-an-ideal-fluid_ru.pdf -- 359.3 Кб -- 28.10.2015 Похожие документы
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...