In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>7) - bioinf.fbb.msu.ru/ )

... 1967-1972: Undergraduate: M.V. Lomonosov Moscow State University, Department ofТљMechanics and Mathematics. ... 1980-1987: The Deputy Dean for science and research, Department ofТљMechanics and Mathematics, M.V. Lomonosov Moscow State University . ... 1997-2001: The Deputy Minister ofТљthe Education ofТљthe Russian Federation . ... since 2003: Head ofТљDepartment ofТљMechanics, Steklov Mathematical Institute, Russian Academy ofТљSciences . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>113) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Staff - Bizyaev Ivan A
• Institute of Computer Sciences - Staff

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>6) - newcryst.phys.msu.ru/ )

• Search of novel crystalline materials

MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...

Еще в разделе: (Показать все результаты (>14) - www.sciencepark.ru/ )

• MSU Science Park - History
• MSU Science Park
• MSU Science Park - News

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>8) - biophys.msu.ru/ )

• C U R R I C U L U M V I T A E
• A.B.Rubin - Curriculum vita
• CURRICULUM VITA

. N.N.Bogoliubov Institute for Theoretical Problems of Microphysics . M.V.Lomonosov Moscow State University . Choose encoding: . The URL for ITPM MSU Web Page is http://itpm.msu.su . If you have remarks or suggestions please send your comments to . (C) Copyright ITPM MSU 1997, 1998, 1999

Еще в разделе: (Показать все результаты (>189) - itpm.msu.su/ )

• Overview of the Directory Tree
• IP Networks
• Links

Moscow State University Belozersky Institute of Physico-Chemical Biology . ... Snail-mail: A.N. Belozersky Institute of Physico-Chemical Biology Moscow State University, GSP-1, 119991 Moscow, Russia . ... Russia . 1993-1996 Post Graduate Student, A.N.Belozersky Institute of Physical and Chemical Biology, Moscow State University, Moscow, Russia . 1996-present Senior Researcher, A.N.Belozersky Institute of Physical and Chemical Biology, Moscow State University, Moscow, Russia. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

Russian depictives and attributives: the role of the verb Russian secondary predicates can use two different case patterns: the instrumental case or the agreeing case. In this paper we discuss the behavior of the adjective in the position of the secondary predicate and we refer to the patterns of agreement discussed above as depictive constructions (taking the instrumental) and attributive constructions (taking the agreeing case), see the examples (1-2). ... Predicate nouns in Russian. ...

Еще в разделе: (Показать все результаты (>261) - www.philol.msu.ru/ )

• International Congress "Russian Language: its Historical Destiny and Present
• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/teaching.html
• II International Congress of Russian Language Researches - Information letter

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey Zhumatiy Research Computing Center, Lomonosov Moscow State University, Moscow, Russia {asa,dan,shpavel,sergeys,cstef,vadim,voevodin,serg}@parallel.ru 1 Introduction ... 2 The Octotron System: Model-based Approach Octotron represents the supercomputer model in the form of a graph (Fig. ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• INTRODUCTION | Moscow University Supercomputing Center
• Supercomputing Education Project | Moscow University Supercomputing Center
• MSU's HPC HISTORY | Moscow University Supercomputing Center

МОСКОВСКИЙ . ГОСУДАРСТВЕННЫЙ . УНИВЕРСИТЕТ . имени . М.В.ЛОМОНОСОВА . ... ФАКУЛЬТЕТ . ... МАТЕМАТИЧЕСКОЙ ФИЗИКИ . ... Московский государственный университет . имени М.В.Ломоносова (факультет ВМК) . ... университет имени М.В.Ломоносова факультет ВМК . ... федеральное государственное бюджетное образовательное учреждение высшего образования 'Московский государственный университет имени М.В.Ломоносова' ОГРН: 1037700258694 . ... МГУ имени М.В.Ломоносова (Факультет ВМК ) . ...

Еще в разделе: (Показать все результаты (>54) - mph.cmc.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:41:26 Mon, 06 Dec 2010 09:36:59 GMT darkhan [49:94406d1874a2] * Automata.py ( modified ) * Interface.py ( modified ) * State.py ( modified ) repr in State, little optimized Automata, cell_size = 8, delay = 1 Sun , 05 Dec 2010 14:23:16 GMT is_rusinov [48:dd0494c85c81] * Interface.py ( modified ) some corections Sun , 05 Dec ...

Еще в разделе: (Показать все результаты (>229) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=f411a1e0a5cb2ed686b8178b355538a6b98e6cf7&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=49%3A94406d1874a2&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=50%3A9cbbff6dbbaf&limit=100&mode=stop_on_copy

... MSU Chamber Orchestra . ... Concerto МГУ . ... Georg Fridrich HANDEL . ... May 1 (Sunday), 6.00 p.m. Baptist Church in Zelenograd. buses 9, 11 or taxi 131 from metro station 'Rechnoj vokzal'. tel. ... May 2 (Monday), 6.00 p.m. Moscow Baptist Church 'Resurrection'. metro station 'Kashirskaja', Kashirskoe shosse, 70, bld. 2. tel . ... May 4 (Wednesday), 7.00 p.m. The 2 nd Moscow Baptist Church. metro stations 'Tulskaja' or 'Nagatinskaja', Varshavskoe shosse, 12 А . ... MSU CHAMBER ORCHESTRA . ...

Еще в разделе: (Показать все результаты (>19) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Index.

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>22) - qsar.chem.msu.ru/ )

• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry
• Orlov, Alexey A. - Laboratory of Medicinal Chemistry
• Voronkov, Andrew E. - Laboratory of Medicinal Chemistry

... Полная версия этой страницы: The Significance of Non-ergodic Property of Statistical Mechanics Systems for Understanding Resting State of a Living Cell . ... The Significance of Non-ergodic Property of Statistical Mechanics Systems for Understanding Resting State of a Living Cell . ... In his physical theory of the cell, American physiologist Gilbert Ling introduced an important notion of the resting state of the cell. ...

Еще в разделе: (Показать все результаты (>1053) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Постдок: теоретическая физика высоких энергий.
• Студенческий форум Физфака МГУ > Аспирантура: теоретическая физика высоких
• The Significance of Non-ergodic Property of Statistical Mechanics Systems for

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>80) - brain.bio.msu.ru/ )

• Alexander Zhigalov
• S.Borisov
• Sergei Shishkin * Сергей Шишкин

... School of Public Administration . Lomonosov Moscow State University . ... Moderator: Prof. V.A.Nikonov, Dean, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. A.I. Solovyov, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. A.V. Surin, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. V.G. Koshkidko, School of Public Administration, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>65) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/mejdunarodnaja_letnjaja_shkola_povishenija_kvalifikazii_prepodavatelei/6_shkola.pdf
• Visa Support Information

. Bulk of the information is in the Russian version . Go there if you can read Russian . General Information . Personalia . Science and Publications . Uralian Expedition . Crimean Student Practice . Uralian Student Practice . Software , Miscelaneous Informationx . Photoalbums . Address any question to and@geol.msu.ru

Еще в разделе: (Показать все результаты (>16) - sbmg.geol.msu.ru/ )

• Europrobe2

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Aleksandra A. Panyutina . ... Born in Moscow on March, 17, 1984 . Education: Moscow State University (MSU), Biological faculty, 2002-2007. ... Key words: mammalian flight, arboreal locomotion, functional anatomy, bats, gliders, locomotion biomechanics . Research interests: functional anatomy, transformation of locomotor apparatus of tetrapods in the process of adaptation to new habitats, origin and evolution of aerial locomotion in mammals. ORCID: http://orcid.org/0000-0002-8379-8526 . ...

Еще в разделе: (Показать все результаты (>1201) - zmmu.msu.ru/ )

• XIV International Ornithological Conference of North Eurasia: Organizers
• National bat report
• Tsytsulina Katerina