BUSINESS ENGLISH LESSON PLAN FOR THE SECOND-YEAR STUDENTS: III SEMESTER OF 2012-2013 ACADEMIC YEAR This business English lesson plan has been designed for students of the Faculty of Mathematics and Mechanics as a follow-up to the previous Business English lesson plan. ... English for Business. ... Lessons are arranged according to the situations that the students will encounter in the job market. ... What are some jobs that some people think only one gender can do, but can be done by either gender? ...
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...
ЛАБОРАТОРИЯ . АВТОМАТИЗИРОВАННЫХ . ... 20 1 3 г. 20 1 2 г. 20 1 1 г. 20 1 0 г. 2008 г. 2007 г. Публикации сотрудников лаборатории 2009 г. Сборники . ... Рафаева А.В. Научная, "наивная" и фольклорная картина мира // Педагогические технологии. ... Kazakevich, Olga. Language changes speeded up // The 16 th World Congress of the International Union of Anthropological and Ethnological Sciences. ... The 16 th World Congress of the International Union of Anthropological and Ethnological Sciences. ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Scientific goals . Cosmic rays of extremely high energy . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... An attempt to register cosmic rays of extremely high energy of ~10 19 -10 20 eV, i.e. in the region of GZK-cut-off, . Today in high energy region we have only limited and contradictory information about the energy spectrum and chemical composition of the particles. ...
Asteroids, Comets, Meteors (2008) 8010.pdf SPECTRAL SIGNS OF CARBONACEOUS CHONDRITIC MATERIAL ON (21) LUTETIA V.V. Busarev, Sternberg Astronomical Institute (SAI), Moscow University, Universitetskij pr., ... We have discovered considerable variations in the continuum slope and shape of the visible-range reflectance spectra of the asteroid with rotation in November 2004 (4/5, 5/6 and 7/8) and March 2006 (3/4). ... Resulting normalized (at 0.55 m) and smoothed reflectance spectra are shown in Fig. ...
Uneex . SeminarTraffic . ... Анализ трафика -- зачем это нужно. ... Источники информации о трафике. ... Cisco accounting и NetFlow ( вот тут информации недостаточно, если кто-то может рассказать про эту часть -- хорошо ). ... В формате SXI (ooImpress) . ... Обзор биллинговых систем и систем учета трафика: http://www.opennet.ru/prog/sml/47.shtml . ... Интересная разработка: система адаптивного агрегирования информации о трафике. http://camelot.iki.rssi.ru/RFFI-02-07-90390 . ... Action: . ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
Division of Geology . ... Division of Hydrogeology and Engineering Geology . ... Faculty of geology > English > Divisions & Departments . ... The graduates of "Engineering geology" specialization must have a vast geological background and know the state-of-the-art methods of studies and forecast of engineering-geological conditions for industrial, urban, hydrotechnical, road and underground construction. ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. ...
... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
... Laser coherent control of molecular chiral states via entanglement of the rotational and torsional degrees of freedom Stanislav S. Bychkov,1 Boris A. Grishanin,1 Victor N. Zadkov1* and Hiroaki Takahashi2 , Faculty Physics International of end Laser Center, v, Lomonosov M. Moscow Stete University, Moscow 119899, Russia 2 Department Chemistry, of Waseda University, Tokyo169-8555, Japan Received June 21 2002;Accepted15August 2002 A new mechanism tor controlling ...
Langmuir 2005, 21, 8243-8249 8243 The "Wimple": Rippled Deformation of a Fluid Drop Caused by Hydrodynamic and Surface Forces during Thin Film Drainage Lucy Y. Clasohm,, Jason N. Connor,,| ... In Final Form: June 16, 2005 It is well-known that hydrodynamic pressures in a thin draining liquid film can cause inversion of the curvature of a drop or bubble surface as it approaches another surface, creating a so-called "dimple". ... WimplesRippled Deformation of a Fluid Drop Langmuir, Vol. ...
... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Wavelet Analysis of Fine-Scale Structures in the Saturnian B and C Rings Using Data from the Cassini Spacecraft E. B. Postnikova and A. Yu. ... These factors are especially important for the fine-scale structure of Saturn's A ring. ... The efficiency of the wavelet transform with a simple Morlet wavelet basis in solving this task was successfully demonstrated by our study of resonance structures in Saturn's A ring [10]. ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
Press release 20 July 2011 New funding for early-career top researchers from anywhere in the world: 730 million for new "ERC Starting Grant" call The European Research Council (ERC) today opens its fifth call for proposals for the "ERC Starting Grants", targeted at early-career top researchers of any nationality, working - or moving to work - in host institutions in Europe. ... Last year, the success rate of Starting Grants proposals was around 15%. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы