... Вакансии . ... You ll deliver remote hardware support service to large enterprise and commercial customers . ... The primary responsibility of the Solution Centre Engineer (SCE) is to manage reactive customer cases to a satisfactory resolution. ... On receipt of a service request the SCE researches a solution through remote diagnosis, documentation and/or knowledge databases within agreed timeframes. ... Knowledge generation and support of customers to use existing knowledge repositories . ...

Еще в разделе: (Показать все результаты (>173) - www.physcareer.ru/ )

• Field Support Engineer (Intern/Student) / Стажировки / Physcareer.ru
• Business Operations Analyst (Graduate) / Вакансии / Physcareer.ru
• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• Rikho Nymmik

... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>3) - photonics.phys.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> On ne devrait pas exister . Пользователи . Демо . Деньги . Фильмы . Форум . On ne devrait pas exister . Франция 2006 . отметить . Комедия . Драма .

Еще в разделе: (Показать все результаты (>217) - kinfo.ru/ )

• Does God Exist? - Фильмы - Kinfo.ru
• Computer Boy - Фильмы - Kinfo.ru
• Jours o? je n'existe pas, Les - Фильмы - Kinfo.ru

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению
• Кафедра ЮНЕСКО по изучению глобальных проблем на факультете глобальных

... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...

Еще в разделе: (Показать все результаты (>25) - ferro.phys.msu.ru/ )

• Special courses for the students of Physics Faculty, specialized at the...
• Physics Department of Moscow State University

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Проблемы с MSDN, что c VS2005 Feb CTP . ... Re: Проблемы с MSDN, что c VS2005 Feb CTP [ re: dimich ] . ... А кто-нибудь ставил VS2005 Feb CTP + MSDN (что с ним же)? ...

Еще в разделе: (Показать все результаты (>1772) - www.snto-msu.net/ )

• Re: Pedobear. He exists! - Public forum of MSU united student networks
• Продам computer без блока питания и HDD - Public forum of MSU united student
• For sale: AMD AM2 4000+ based computer + Asus flat display 22" - Public forum

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

Laboratory of Micro- and Nanofluidics . ... Prof. Dr. Olga I. Vinogradova . ... Research . ... Job and Diploma/PhD . ... PhD student, Junior Research Fellow . ... Salim R. Maduar studied chemistry at the M.V.Lomonosov Moscow State University. In 2010-2011 he in addition studied functional nanomaterials, and since 2011 studied bionanotechnology at the MSU Nanotechnology Education and Research Center . ... In 2011 he joined the group of Prof. Olga I. Vinogradova to work on his Diploma thesis. ...

Еще в разделе: (Показать все результаты (>61) - nanofluidics.phys.msu.ru/ )

• Tatiana V. Nizkaya
• Taras Y. Molotilin
• Olga I. Vinogradova

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>16) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>29) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Ayvazyan_Introduction_to_the_textbook_on_econometrics.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Text_Eng.pdf
• http://www.mse-msu.ru/Nekipeliv_31012011.pdf

... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>37) - www.srcc.msu.ru/ )

The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches ­ Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control ­ Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...

Еще в разделе: (Показать все результаты (>10) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf
• About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>15) - www.hsib.msu.ru/ )

• General information | Высшая школа инновационного бизнеса МГУ

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

... Under existing condition of world crisis, Russian society is facing new challenges. ... Russian political system desperately needs reformation and society needs change in social and economic activities. On one hand, world crisis complicates this process, but on the other it makes in inevitable if government wants to keep political system stable, and society wants to evolve, not to degrade. ...

Еще в разделе: (Показать все результаты (>127) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/4/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/3/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/4/07.pdf

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of colloidal quantum dots on InP based biomarkers to create . ... For this it is necessary to carry out the replacement of stabilizing shells . ... To replace the membranes using standard samples CT InP, MA stabilized , since the latter is quite labile ligand , as well as samples of heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ...

Еще в разделе: (Показать все результаты (>65) - www.lssm.inorg.chem.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )