... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>32) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov
• Summaries of articles

Laboratory of Micro- and Nanofluidics . ... Prof. Dr. Olga I. Vinogradova . ... Research . ... Job and Diploma/PhD . ... PhD student, Junior Research Fellow . ... Salim R. Maduar studied chemistry at the M.V.Lomonosov Moscow State University. In 2010-2011 he in addition studied functional nanomaterials, and since 2011 studied bionanotechnology at the MSU Nanotechnology Education and Research Center . ... In 2011 he joined the group of Prof. Olga I. Vinogradova to work on his Diploma thesis. ...

Еще в разделе: (Показать все результаты (>61) - nanofluidics.phys.msu.ru/ )

• Tatiana V. Nizkaya
• Taras Y. Molotilin
• Olga I. Vinogradova

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>118) - www.msm.biophys.msu.ru/ )

... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>37) - www.srcc.msu.ru/ )

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>15) - www.hsib.msu.ru/ )

• General information | Высшая школа инновационного бизнеса МГУ

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

... DESCRIPTION # # Computes combination between two (or more) .cube files (e.g. the output # of Siesta's grid2cube). ... added. # use strict; #-------------# # Variables # #-------------# my $svn_revision = r97 2007-06-29 18:02:55 ; my @ files ; # list of files to process my %do; # what to do with each file ( file = +1/-1) my $ atoms ; # string with atoms and geometry my %fb; # hash with file = [@bulk] info my @gnp; # (n1,n2,n3) - ...

Еще в разделе: (Показать все результаты (>36) - erg.biophys.msu.ru/ )

• Visualize partial charges in PyMol ERG Research Group: Лаборатория

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

... I.V. Yaminsky, A.S. Filonov, A.V. Shishlova, V.V. Lyulevich, A.V. Stepanov. ... Proceedings of All-Russian Conference "Scanning Probe Microscopy - 99" (in Russian), Nizhny Novgorod, 10-13 March 1999, р.141-144. ... A.V. Shishlova, I.V. Yaminsky. ... Proceedings of All-Russian Conference "Scanning Probe Microscopy - 2000" (in Russian), Nizhny Novgorod, February 28. ... Abstracts of the VII All-Russian Conference "Molecular systems structure and dynamics" (in Russian), Yalchik, 2000, p.71. ...

Еще в разделе: (Показать все результаты (>118) - www.spm.genebee.msu.ru/ )

• Image formation and processing methods
• DSP board program
• SPM Set-up

... LOMONOSOV MOSCOW STATE UNIVERSITY MAJOR GOAL OF IHSS-14 Expand the existing attitude towards humic substances as components of organic matter in soil and water to understanding their potential as alternative sustainable feedstocks for the chemical industry. ... LOMONOSOV MOSCOW STATE UNIVERSITY GAPS IN THE KNOWLEDGE -2 · IDENTITY CRISIS OF HUMIC SUBSTANCES: CLASSIFICATION OF HS AS CARBON FEEDSTOCK FOR DIFFERENT INDUSTRIAL NEEDS IS NEEDED To apply humic substances, we will need to classify them. ...

Еще в разделе: (Показать все результаты (>186) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/seminar/mat/Paper-Crystallization-Eng.pdf

... Under existing condition of world crisis, Russian society is facing new challenges. ... Russian political system desperately needs reformation and society needs change in social and economic activities. On one hand, world crisis complicates this process, but on the other it makes in inevitable if government wants to keep political system stable, and society wants to evolve, not to degrade. ...

Еще в разделе: (Показать все результаты (>126) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/4/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/3/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/4/07.pdf

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of colloidal quantum dots on InP based biomarkers to create . ... For this it is necessary to carry out the replacement of stabilizing shells . ... To replace the membranes using standard samples CT InP, MA stabilized , since the latter is quite labile ligand , as well as samples of heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ...

Еще в разделе: (Показать все результаты (>64) - www.lssm.inorg.chem.msu.ru/ )

... Python . ... О UNИX . ... ApacheOnWin32 . ... C:\Apache . ... Choose a location appropriate for you; the following instructions assume you will be creating one or more wiki instances in C:\Moin\ and the first wiki instance will be named mywiki . ... This will create a clone of the MoinMoin wiki in the mywiki folder. cd C:\ md Moin md Moin\mywiki md Moin\mywiki\data md Moin\mywiki\underlay cd \Python\share\moin xcopy data C:\Moin\mywiki\data /E xcopy underlay C:\Moin\mywiki\underlay /E copy config\*....

Еще в разделе: (Показать все результаты (>240) - uneex.mithril.cs.msu.su/ )

• HelpOnParsers/ReStructuredText - UNИX
• WikiCourse/52 Structure in the wiki - UNИX
• Meetings/Murray - UNИX

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

... Преподаватели физфака . ... Карта сайта . О сайте . ... 06.04 Добавлено 8 новых мнений о преподавателях . ... 05.04 Плохотников (0) 05.04 Грибов (+2) 05.04 Чуркин (+2) 05.04 Чичикина (-2) 05.04 Гришунин (+1) 05.04 Катихин (+2) 03.04 Овчинников (-1) 03.04 Андреев (-1) 01.04 Пименов (+2) 01.04 Коростелева (-1) 01.04 Хлопьянов (+2) 01.04 Касьянова (-1) 31.03 Вшивцева (+1) 31.03 Козлов (+2) 31.03 Козлов (+2) 30.03 Овчинников (+2) . ... 2002-2012 Студенческий сайт Физического факультета МГУ Контакты . ...

Еще в разделе: (Показать все результаты (>4) - www.dubinushka.ru/ )

... It carries out the basic communication op erations, such as b oundary exchanges and transp ositions of decomp osed data. ... Data distribution b efore transp osition. б б бвб бв б б б бвбв б бв б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвбв б б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б бвб бв б б б б бвбв б бв бвбв б бв бвбв б бв бвбв б бв бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б ...

Еще в разделе: (Показать все результаты (>7) - geophys.srcc.msu.ru/ )

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>19) - www.rochesterastronomy.org/ )

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>26) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/new_details_v2.pdf
• http://curl.sai.msu.ru/mass/download/doc/res2007eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/new_mass_cat.pdf

... Время и взаимодействие . ... Гравитация как следствие расширения среды весомых тел [размещено на сайте 15.05.2009] . ... С.176-206 (PDF-файл, 1.2 Мб) [обновлено на сайте 15.04.2009] . ... PDF-файл, 7577 Кб) [размещено на сайте 03.11.2013] . ... Время и квантовое поведение (PDF-файл, 630 Кб) [размещено на сайте 09.06.2006] . ... Interacting Two-Time Physics Field Theory With a BRST Gauge Invariant Action (PDF file, 300 Kb) [distributed 01.07.2007] . ... PDF-file, 233 Kb), [Distributed 08.11.2010]. ...

Еще в разделе: (Показать все результаты (>26) - temporology.bio.msu.ru/ )

• Russian Roulette / Русская Рулетка
• Institute Laboratory-Chairs

... 24 Окт 2015 . кем editor | ... 17 Ноя 2015 . ... 6 Дек 2015 . ... Декабрь 2015 . Ноябрь 2015 . Октябрь 2015 . Сентябрь 2015 . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>102) - elana.sinp.msu.ru/ )

• dead computer contest | С Днем Победы!
• cheap the nort | С Днем Победы!
• ray ban outlet uk Types of File Transfer Service | С Днем Победы!