... Астронет | ... планета Астронет | ... Семинары | ... Математический семинар В.И.Арнольда (МГУ) . 11.09.2001 . ... Periodic solutions of the N-body problem and applications to the planet system with satellites. http://www.botik.ru:8101/~duzhin/arnsem.html . Семинар отделения теоретической физики ФИАН по теории твердого тела . ... Кластерная фаза: теория и эксперимент. http://www.tamm.lpi.ru/seminars1/volkov.html . Семинар ФТИАН "Квантовые компьютеры и квантовые вычисления" . ...

Еще в разделе: (Показать все результаты (>6343) - www.astronet.ru/ )

• Астронет > Математический семинар В.И.Арнольда (МГУ)
• Астронет > sample
• Астронет > К 90-летию Лео Голдберга

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>18) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf

University Satellites and . Space Science Education . ... A SERIES OF ATLASES ON METHODS OF SPACE IMAGES INTERPRETATION AS A NEW TOOL FOR REMOTE SENSING EDUCATION IN EARTH SCIENCES . ... Special manuals in the form of atlases of satellite images and their interpretation results are within the best tools for support of the geographical and ecological research and thematic mapping. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>54) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University
• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Brown x26; Mussett The Inaccessible Earth 01 Introduction.pdf . ... Brown x26; Mussett The Inaccessible Earth 02 Chapter.pdf . ...

Еще в разделе: (Показать все результаты (>52) - ocean.phys.msu.ru/ )

• Index of /courses/geo/lectures-addons/
• Index of /courses/geo/lectures-addons-11/
• Index of /courses/geo/lectures-addons/02/

... ЭОС истфака МГУ . ... x25BA; Кафедра исторической информатики . ... Course categories: Кафедра истории средних веков Кафедра исторической информатики Кафедра исторической информатики / Практика использования ДОТ Кафедра истории России до начала XIX века Кафедра новой и новейшей истории стран Европы и Америки Кафедры этнологии Археографическая лаборатория Школа учителей истории . ... Информационные технологии и математические методы в исторических исследованиях и образовании . ... Home ...

Еще в разделе: (Показать все результаты (>4341) - www.hist.msu.ru/ )

• ЭОС истфака МГУ: Course categories
• Электронная образовательная среда исторического факультета МГУ имени
• Summary of История России

... Oxidative phosphorylation and respiratory control phenomenon in Paracoccus denitrificans plasma membrane. ... Changes in respiratory activity, transmembrane electric potential, and ATP synthesis as induced by additions of limited amounts of ADP and P(i) to tightly coupled inverted (inside-out) Paracoccus denitrificans plasma membrane vesicles were traced. ... The data support the kinetic mechanism of the respiratory control phenomenon. ...

Еще в разделе: (Показать все результаты (>72) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | The physiological role of
• Sulfated and sulfonated polymers are able to solubilize efficiently the protein
• Biochemistry Department of Moscow State University | Mechanism of mitochondria

NPAE 2012 4-th International Conference Current Problems in Nuclear Physics and Atomic Energy (NPAE-Kyiv2012) September 10 - 14, 2012 Kyiv, Ukraine Dear colleagues, This is the first circular of the 4-th International Conference on Current Problems in Nuclear Physics and Atomic Energy (NPAE-Kyiv2012), which will be held from September 10 to September 14, 2012 in Kyiv, Ukraine. ... 36, Kyiv), near Metro station Vasylkivska. ... Conference fee and registration Registration fee for participants 250 Euro. ...

Еще в разделе: (Показать все результаты (>179) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/b4b/Announce-3.doc
• http://phys.msu.su/rus/news/latest/programme_lectures_MSU_Farle_2014.pdf
• http://phys.msu.su/rus/news/latest/poster.pdf

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>18) - imaging.cs.msu.ru/ )

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>3) - www.rlcentre.com/ )

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>14) - ani.cmc.msu.ru/ )

• Courses | Department of the Automation for Scientific Research CMC MSU
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

... Borexino . ... SCIENCE AND TECHNOLOGY OF BOREXINO: A REAL TIME DETECTOR FOR LOW ENERGY SOLAR NEUTRINOS (pdf) . Solar neutrino experiments and Borexino perspectives (pdf) . Detection of Supernova Neutrinos by Neutrino-Proton Elastic Scattering (pdf) . BOREXINO: A REAL TIME LIQUID SCINTILLATOR DETECTOR FOR LOW ENERGY SOLAR NEUTRINO STUDY (pdf) . Confronting Spin Flavor Solutions of the Solar Neutrino Problem with current and future solar neutrino data (pdf) . ... CAN 2.0 стандарт (pdf) . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>81) - textbook.sinp.msu.ru/ )

• Index of /modules/ax_content/atomax/spaw
• Index of /modules
• Index of /modules/ax_content

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>148) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/150e.pdf
• Scientific conference Women in chemistry: biographical portrait, contribution

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>8) - www.fbm.msu.ru/ )

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Еще в разделе: (Показать все результаты (>22) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/theses1.pdf
• http://www.eng.math.msu.su/download/theses3.pdf

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>73) - www.msm.biophys.msu.ru/ )

... Projectile proton energies are above 300 keV Scattering angles are of fractions of mrad . ... C.D. Lin) FBA Exact representation of the amplitude so called paraxial approximation for fast proton Exact representation of the amplitude Basis for SBA and EWBA Integral representation of EWBA (eikonal) Integral representation of the FBA CALCULATIONS: Charge transfer Hong-Keun Kim et al Phys . Rev. A 85, 022707 (2012) Powerful note All helium wave functions, both ... Phys. Rev. A 71 (2005), 12706. ...

Еще в разделе: (Показать все результаты (>10) - lmmqsp.sinp.msu.ru/ )

• Laboratory of Mathematical Models of Quantum Scattering Processes / MSU

Challenges of Data Processing for Earth Observation in Distributed Environments Dana Petcu Abstract. ... Earth observation (EO) is most often referring to satellite imagery or satellite remote sensing, the result of sensing process being an image or a map. ... Data Processing. ... The parallel remote-sensing image processing software PRIPS was encapsulated into a Grid Challenges of Data Processing for Earth Observation in Distributed Environments 13 service in [20]. ... Remote Sensing Grid. ...

Еще в разделе: (Показать все результаты (>43) - angel.cs.msu.su/ )

• : Interface NetcdfService
• Index of /~oxana
• Index of /~oxana/image_processing