... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>95) - td.chem.msu.ru/ )

... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... This guide primarily deals with the issues relevant to the conception and creation stages of development, and much less with the implementation stage. ... Most importantly, the material on Start-Up Company Development is presented to help your start-up succeed. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>31) - innovation.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Nov4-Nov12_2007.doc

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>24) - www.inorg.chem.msu.ru/ )

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>9) - polit.msu.ru/ )

• Новости факультета

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>47) - cosmos.msu.ru/ )

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>10) - www.ecocoop.ru/ )

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>65) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Galss_ceramics.pdf
• http://chaos.phys.msu.ru/prokhorov/index.htm

... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• We are assembling training courses! | MSU Higher school of management and
• Opening of the educational programme - School of CEOs, "Capsule of security"
• School overview | MSU Higher school of management and innovation

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>84) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation
• Index of /modules/ax_content/atomax/spaw/lib/themes/default/img

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>76) - music.genebee.msu.ru/ )

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>4) - www.rlcentre.com/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

157. Отчет Гришатовой Юлии (лето 2001г.)

158. Центр дистанционного образования физического факультета МГУ имени М.В...

159. The Database of Close Binary Systems

160. http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf