... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>22) - www.inorg.chem.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>41) - eng.geogr.msu.ru/ )

• History
• Department of Cartography and Geoinformatics

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>15) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ

... Описание вакансии: . The Famous FMCG Company (Top-3) looks for Standards Office Manager in R Department . ... Create and register R and Regulatory documentation . ... Manage update of documentation in valid forms. Daily tracking of documentation validity and make changes in proper time to ensure the correct and on time activity of commercial production. ... Fluent English and excellent computer skills, skills to work with the databases . High skills to work with people; teamwork skills . ...

Еще в разделе: (Показать все результаты (>29) - www.chemport.ru/ )

• "Head of chemistry" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "R@d manager" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• Harry Potter and the Half-Blood Prince. Book 6 / Гарри Поттер и Принц

Title Author Key words Review of the monograph Yu.G. Volkova "Creativity: creativity against imitation" Dmitriev A.V. creative class, creativity, creative, imitation This article is reviewed monograph Yu.G. Volkova "Creativity: creativity against imitation" (2013). ...

Еще в разделе: (Показать все результаты (>40) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/05.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/17.pdf

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>45) - sn.sai.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf
• http://seac47-2.phys.msu.ru/proc/E16_Nosov_Skachko.pdf

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>15) - polit.msu.ru/ )

• Новости факультета

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>51) - cosmos.msu.ru/ )

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>8) - www.ecocoop.ru/ )

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• StructAlign help

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

155. http://curl.sai.msu.ru/mass/download/doc/sv_ug.pdf

156. http://chaos.phys.msu.ru/prokhorov/diplom/diplom.htm

157. Message from Victor Antonovich Sadovnichy - Rector of Lomonosov Moscow State

158. http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf

159. "ABOUT RUSSIAN" - журнал о русских людях и их языке

160. Отчет Гришатовой Юлии (лето 2001г.)