. Skip to main content . X-COM parallel.ru . Главная . Возможности . Примеры . Дистрибутивы . Документация . Публикации . Обратная связь . О проекте . Свидетельства Роспатента ?2006611620 и ?2008614856 . Государственный контракт ?02.514.11.4035 от 18.05.2007 . љ .

Еще в разделе: (Показать все результаты (>2) - x-com.parallel.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>7) - tex.bog.msu.ru/ )

... 17, No. 10 (2007) 3603­3606 c World Scientific Publishing Company STABILIZATION OF CHAOTIC BEHAVIOR IN THE RESTRICTED THREE-BODY PROBLEM ARSEN DZHANOEV and ALEXANDER LOSKUTOV Physics Department, Moscow State University, Leninskie Gory, Moscow 119992, Russia janoev@pol ly.phys.msu.ru Loskutov@chaos.phys.msu.ru Received Octob er 19, 2005; Revised February 20, 2006 The restricted three-bo dy problem on the example of a perturbed Sitnikov case is considered. ... The Sitnikov problem. ... Fig. ...

Еще в разделе: (Показать все результаты (>73) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Letter_to_editor.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Coding_Engl_MSU.pdf

... Program . ...

Еще в разделе: (Показать все результаты (>40) - pont2008.cmc.msu.ru/ )

Contamination of soils and deeper sediments by toxic metals, metalloids, and radionuclides is a worldwide problem due to improper disposal practices, spills, atmospheric deposition of combustion emissions, and intentional application of sludges, fertilizers, or other materials. ... Microbial reduction of chromate, for example, may convert highly mobile Cr(VI) to less mobile Cr(III). In other cases, changes in metal redox state may be indirectly caused by microbial activity. ...

Еще в разделе: (Показать все результаты (>20) - eco.soil.msu.ru/ )

• Acid Deposition and Forest Soils. Eds. V.Nikonov G.Koptsik

... RUBRRRIKA RUBRIKA Evolution of the Quantitative Measures of Quantum Information: on the Path to a Unified Theory of Quantum Information B. A. Grishanin and V. N. Zadkov Physics Faculty and International Laser Center, Moscow State University, Moscow, 119992 Russia e-mail: grishan@comsim1.phys.msu.su Received July 11, 2002 Abstract--The most general approaches to determining the quantitative measure of quantum information are analyzed based on physical content. ... with an arbitrary state | ...

Еще в разделе: (Показать все результаты (>77) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>50) - hpc.msu.ru/ )

Academy of Science, Engineering and Technology International Journal of Mathematical, Computational, Physical and Quantum Engineering Vol :8 No:10, 2014 Application of Adaptive Neural Network Algorithms for Determination of Salt Composition of Waters Using Laser Spectroscopy Tatiana A. Dolenko, Sergey A. Burikov, Alexander O. Efitorov, Sergey A. Dolenko ... Nickolov, "Determination of salts in water solutions by a skewing parameter of the water Raman band," Applied Spectroscopy, vol. 38, no. 4, pp. ...

Еще в разделе: (Показать все результаты (>34) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/Assets/Water/OMNN_2010.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... Полная версия: Выступления ансамбля Студии . Грация-МГУ::Форум > Мультимедия > Видео . ... Nov 10 2006, 05:27 . Добавил на сайт две записи с выступлениями ансамбля "Грации-МГУ" . http://grace.msu.ru/content/view/70/26/ . ... Opera 9.01 - полет нормальный... http://www.youtube.com/watch?v=L6smD7_GibQ . http://www.youtube.com/watch?v=xY7lUnopZYU . ...

Еще в разделе: (Показать все результаты (>25) - grace.msu.ru/ )

• Выступления ансамбля Студии - Грация-МГУ::Форум
• Грация-МГУ::Форум > интересно интервью со Славиком Крикливым и Анной...
• Грация-МГУ::Форум > Всем фтыкать со страшной силой

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>7) - ccoe.msu.ru/ )

• CUDA Center of Excellence | MSU | CCoE MSU
• GPUs Accelerate Supercomputing in Russia | CUDA Center of Excellence | MSU
• The NVIDIA Graduate Fellowship Program | GPU Center of Excellence МГУ

... Пример: ?Ни фига себе сайт $shocked$?. ... Link] 31.07.06 11:46:19 I/O Admin : . ... Наш сайт теперь включен в Каталог Яндекса!! ... META http-equiv="Content-Type" content="text/html; charset=windows-1251">. ... Link] 16.07.06 15:42:32 Site Content Admin : . Пора готовить сайт к началу учебного года. ... Link] 29.06.06 00:25:01 AlexeY : . ... META http-equiv="Content-Type" content="text/html; charset=win-1251"> . ... Присылайте свои материалы, пополняйте коллекцию, пожалуйста! ... 2016, DMVN . ...

Еще в разделе: (Показать все результаты (>29) - www.dmvn.mexmat.net/ )

... Новости . Объявления . Контакты . ... Расписание . О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . Расписание экзаменов 415 группы. ... Кафедра системного анализа ВМК МГУ создана в 1992 году. Организатор и заведующий кафедрой - лауреат Ленинской премии, заслуженный профессор МГУ, академик РАН Александр Борисович Куржанский . ...

Еще в разделе: (Показать все результаты (>4) - sa.cmc.msu.ru/ )

• Выпускники | Кафедра системного анализа ВМК МГУ
• Сотрудники кафедры | Кафедра системного анализа ВМК МГУ
• Send page by email | Кафедра системного анализа ВМК МГУ

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>13) - mph.cmc.msu.ru/ )

Photo-induced delayed luminescence ( DL ) following a visible light excitation in air-dry seeds of various plants has been observed. ... The shape of DL distribution curve depends on homogeneity of seed population. ... Veselova, T.V., Veselovskii, V.A., Rubin, A.B., Bochvarov, P.Z. Delayed luminescence of air-dry soybean seeds as a measure of their viability. ... Veselova, T.V., Veselovsky, V.A., Kozar, V.I., Rubin, A.B. Delayed luminescence of soybean seeds during swelling and accelerated aging. ...

Еще в разделе: (Показать все результаты (>7) - biophys.msu.ru/ )

... Новости . ... Главная Новости Новости . ... 1 октября . ... http://www.ramt.ru/plays/?content=item&item=1238 . ... Красное и черное" . http://www.ramt.ru/plays/?content=item&item=539 . ... Самоубийца" . http://www.ramt.ru/plays/?content=item&item=164 . ... Красное и черное", "Самоубийца" - 4 и 5 октября . ВЫДАЧА БИЛЕТОВ: . Доказательство" - 1 октября . ... ВЫДАЧА БИЛЕТОВ ПО РЕЗЕРВНОМУ СПИСКУ: . ... Для получения билета необходимо иметь студенческий. ... Новости сайта . ...

Еще в разделе: (Показать все результаты (>7) - www.dubinushka.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

... Basic Space Sciences in HighSchool and Cooperation in Space Education Pro jects 9 4 UNIVERSAT-2006 SCIENTIFIC PROGRAMME June 26, 2006, Monday 10:0013:00 Registration 13:0015:00 Lunch 15:0016:30 Opening Ceremony and Invited Reports INVITED REPORTS (30 min) 15:2015:50 Haubold, H.J., The United Nations Basic Space Science Initiative 15:5016:20 Krasotkin S.A., Panasyuk M.I., Radchenko V.V., Space research scientic and educational ... Chalova E.R., Aerospace images in school education 4. ...

Еще в разделе: (Показать все результаты (>51) - cosmos.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>6955) - mouse.belozersky.msu.ru/ )

• Geometrical core
• PLANdbAffy: probe-level annotation database for Affymetrix expression

... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 ­ ­ ­ ­ ­ (chairman ­ M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

• Department of Mathematics, Faculty of Physics, Lomonosov MSU

Форум МГУ Главная Форум > общие > . ... Ответов Просмотров . ... LalBiassE , 4 сен 2012 . Ответов: . ... Просмотров: . ... LalBiassE . 4 сен 2012 . Fewepoxy , 4 сен 2012 . ... Fewepoxy . ... Bimmemituefly , 4 сен 2012 . ... looraPlult , 4 сен 2012 . ... teensecub , 4 сен 2012 . ... Критерий сортировки тем: Дата последнего сообщения в теме Дата создания темы Название темы (по алфавиту) Число ответов Число просмотров Число благодарностей за первое сообщение . ... Главная . Форум . ...

Еще в разделе: (Показать все результаты (>27) - osk.msu.ru/ )