. Updated: 20.08.2009

Еще в разделе: (Показать все результаты (>15) - oc.cs.msu.ru/ )

• Смирнов Алексей Игоревич Кафедра Оптимального управления ВМК МГУ
• EGMD - Economic Growth: Mathematical Dimensions (5-26 июля 2009) Кафедра

... A new mechanical model of parametrically excited pendulum is proposed. ... Schemes of equivalent parametric pendula We consider the pendulum presented in Fig. 1 which is governed by the same dimensionless equation as the pendulum with vertically vibrating pivot in Fig. 2, see [1, 2] and references therein. ... Stability of inverted position As we see in Fig. 3 (for q < 0 see also Fig. 7) the inverted vertical position, = , see Figs. 5 and 6, can be not only stabilized but also destabilized by...

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/HulaHoopSlides2011.pdf
• http://belyakov.imec.msu.ru/papers/Belyakov_Seyranian_6pages2011.pdf

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>29) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... Common information . ... http://apsjournals.apsnet.org/loi/mpmi . ... toc, abstract, full-text . http://www.apsnet.org/mpmi/backissues/ . ...

Еще в разделе: (Показать все результаты (>8) - journals.genebee.msu.ru/ )

• JCatalog journal list

... Current results . Scientific results . ... Microorganism and fungi . ... The microorganisms catalyze important changes in the biosphere, represent the source of the main atmosphere components and responsible for a significant part of the genetic diversity on our planet. ... That?s why the planned work will be an important factor in solving the fundamental problems in biology of microorganisms, while the results will become the basis for the development of new effective biotechnologies. ...

Еще в разделе: (Показать все результаты (>3) - depository.msu.ru/ )

• Plants | depozitariy

... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>6) - hsmi.msu.ru/ )

• Message from Vladimir Petrovich Evtushenkov - the Chairman of the Board of

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . ... Select Type . ... Ref . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Config.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>22) - osk.msu.ru/ )

• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1
• http://osk.msu.ru/forum/members/arbimeorirm.2192/?_debug=1
• http://osk.msu.ru/forum/members/catyfopwbex.2168/?_debug=1

... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...

Еще в разделе: (Показать все результаты (>2) - geol.msu.ru/ )

... Русский язык как иностранный . ... Политика и английский язык . ... Большинство людей, хоть как-то причастных к данной проблеме, признают, что в настоящее время состояние английского языка оставляет желать лучшего, однако вместе с этим ясно, что едва ли даже сознательные меры помогут исправить данное положение дел. ... Он становится скверным и неточным из-за недалекости нашего мышления, а наша собственная неаккуратность в выборе слов, в свою очередь, позволяет нам мыслить на не столь высоком уровне....

Еще в разделе: (Показать все результаты (>22) - genhis.philol.msu.ru/ )

• Lecture course For postgraduate students (General Linguistics Department)

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>5) - margaret.imec.msu.ru/ )

• Pressure Distribution Peculiariry Along Square Canopy

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>6) - phys.web.ru/ )

• Е.Н. Граменицкий, Т.И.Щекина, В.Н.Девятова. Фазовые отношения во фторсодержащей

... Звезды типа Миры Кита и полуправильные Среди пульсирующих переменных звезд поздних классов видное место занимают долгопериодические переменные звезды (ДПП). ... Изменения блеска мирид происходят более или менее регулярно, периоды большинства мирид находятся в интервале от 150 до 600 суток ( рис. ... В 4-м издании Общего каталога переменных звезд (ОКПЗ) ДПП (включая переменные типа Миры Кита, или мириды, и полуправильные переменные поздних классов) составляют самую многочисленную группу переменных. ...

Еще в разделе: (Показать все результаты (>2) - heritage.sai.msu.ru/ )

... Авторский указатель . ... Состав ДНК . ... 1) Экспериментальные данные культивирования смешанной культуры R-, S- и M-диссоциантов P. aeruginosa , DJVU-файл, 48 Кб . ... 4) Состав смешанных культур на стационарной стадии роста , DJVU-файл, 11 Кб . ... Выявление компонентов питания, ограничивающих рост моно- и смешанных культур диссоциантов бактерий Pseudomonas aeruginosa , PDF-файл, 145 Кб . ... Культивирование моно- и смешанных культур диссоциантов бактерии Pseudomonas aeruginosa , PDF-файл, 111 Кб ...

Еще в разделе: (Показать все результаты (>14) - dis.bio.msu.ru/ )

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>2) - dubrovinlab.msu.ru/ )

Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand

Еще в разделе: (Показать все результаты (>2) - lvk.cs.msu.su/ )

Wednesday, August 22nd, 2012 . GTOPO30 is a global digital elevation model (DEM) with a horizontal grid spacing of 30 arc seconds (approximately 1 kilometer)? (http://eros NULL .usgs NULL .gov/#/Find_Data/Products_and_Data_Available/gtopo30_info) . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for August, 2012. ... Наши публикации . ... Публикации за 2010 . Публикации за 2011 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>7) - geo.sai.msu.ru/ )

• GTOPO30 Лаборатория лазерной интерферометрии
• etopo Лаборатория лазерной интерферометрии
• gmt Лаборатория лазерной интерферометрии

... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...