... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
details, including instructions for authors and subscription information: http://www.informaworld.com/smpp/title~content=t713453505 Observations of gamma-ray bursts and a supernovae search at the robotic telescope MASTER V. M. Lipunov ab; V. G. Kornilov ab; A. V. Krylov a; D. A. Kuvshinov b; E. S. Gorbovskoy b; N. V. Tyurina a; A. A. Belinsky a; G. V. Borisov a ... Stellar magnitude >17.8 18.6 ± 0.3 19.4 ± 0.3 Exposure time (s) 45 15 в 30 15 в 30 Comments Upper limit 82 V. M. Lipunov et al. ...
[
Текст
]
Ссылки http://observ.pereplet.ru/images/evgeny/article/2007/transacion.pdf -- 211.7 Кб -- 19.10.2007 Похожие документы
... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...
... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia LINEAR AND NONLINEAR ANALYSIS OF NUMERICAL METHOD FOR DNS OF TURBULENT CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract We study the spectral characteristics of the numerical method for DNS of turbulent convectional flows. ... So far the full numerical simulation of 3-D turbulent convection is very complex problem demanding the large resources. ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...
A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...
... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... 0, Issue 0, 1-8 computing @tneu.edu.ua www.computingonline.net ISSN 1727-6209 International Scientific Journal of Computing SATELLITE IMAGE PROCESSING ON A GRID - BASED PLATFORM Dana Petcu 1), Dorian Gorgan 2), Florin Pop 3), Dacian Tudor 4), Daniela Zaharie 1) 1) 3) Computer Science Department, Western University of Timisoara, B-dul Vasile Parvan 4, 300223 Timisoara, Romania, {petcu,dzaharie}@info.uvt ... MedioGrid: a Grid-based platform for satellite images. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/image_processing/papers/2008-i07-056.pdf -- 2096.0 Кб -- 19.04.2008 Похожие документы
... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...
... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...
... In Chap. ... sign cos : By the theorem on the motion of the center of masses in the space in projections to the related axes .x ; y ; z/ and the theorem on the change of the kinematic moment with respect to these axes, we obtain the following complete system of differential equations in the dynamical quasi-velocity space R1 fvg S2 f; g C R3 fx ;y ;z g: v cos P v sin C y v sin sin P 2 2 z v sin cos C .y C z / D Fx =m; v sin cos C v cos ... I2 n0 d cos with variable coefficient....
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы