... Equivalent models. 3 prl = l ,clay K pclay C clay 1 + l ,s (K ps - C clay ) , (3) and at Kps < C clay prl = l ,clay 1 K pclayC (4) clay where prl - resistivity of rock consisted of a sand - clay mix at parallel connection of capillaries; l,clay ­conductivity of a liquid in clay capillaries; l,s - conductivity of a liquid in sand capillaries; Kpclay - clay porosity; Kps - sand porosity; clay - volumetric clay content in a sandy-clayish mix. ... The code of curves - volumetric clay content and...

Еще в разделе: (Показать все результаты (>59) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/gravity.htm
• http://geophys.geol.msu.ru/shevnin/publ/186.pdf
• Near-surface electrical prospecting laboratory at Moscow University

... Angewandte Chemie International . Chemical Physics Express . ... HYLE - An International Journal for the Philosophy of Chemistry . ... Journal of Molecular Modeling . ... Journal of Vacuum Science & Technology . Polarization Spectroscopy of ordered systems (PSOS Newsletters). PBMRT - Bio/Chemical Journals and Newsletters . Protein Science . Chemical Physics Preprint Database . The Journal of Physical Chemistry . ... Journal of Chemical Information and Computer Science . ...

Еще в разделе: (Показать все результаты (>24) - www.kge.msu.ru/ )

• Дипломные работы
• Публикации

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Издательство Taylor & Francis . Журналы ACM (Association for Computing Mashinery) NEW . Журналы AMS (Американского математического общества) NEW . ... Журналы Sage (Material Science, Health Science) . ... Журналы издательства World Scientific . ... Журнал Science издательства American Association for the Advancement of Science (AAAS) . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>7) - wwwlib.phys.msu.ru/ )

• Библиотека физичеcкого факультета МГУ - Электронные ресурсы

About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...

Еще в разделе: (Показать все результаты (>25) - dbserv.sinp.msu.ru/ )

... Abstract A. V. Dmitriev, A. V. Ivanov, A. R. Khokhlov, Numerical simulation of light propagation through a diffuser, Fundamentalnaya i prikladnaya matematika, vol. 15 (2009), no. 6, pp. ... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker--Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation propagation directions. ... 8, 9] , x1 , : 1 D = (3 - x1 ), 6 3 x1 = 2 d x( )cos sin . ...

Еще в разделе: (Показать все результаты (>17) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf
• Condensed Matter Theory: Index

Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...

Еще в разделе: (Показать все результаты (>2) - smu.cmc.msu.ru/ )

... Osipenko Konstantin Yuryevich . ... Konstantin Yuryevich Osipenko was born in 1950 in Moscow. In 1967 he enrolled in the Faculty of Mechanics and Mathematics of Moscow State University. ... Since September 2008 he is also teaching at the Department of General Control of Mechanics and Mathematics Faculty of Moscow State University. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>86) - new.math.msu.su/ )

• Pobedria Boris Efimovich

... Cerebellar granule cell death induced by aluminum. ... Using flow cytometry of acutely isolated cerebellar granule cell neurons, we have determined the effects of Al (III) on viability, membrane potential, intracellular calcium concentration and generation of reactive oxygen species (ROS). ... While exposure to Al (III) was accompanied by an increase in ROS and an elevation of intracellular calcium concentration, calcium chelators and ROS scavengers did not reduce cell death. ...

Еще в разделе: (Показать все результаты (>46) - biochem.bio.msu.ru/ )

• Measurement of B-type natriuretic peptide by two assays utilizing antibodies

... We study the effect of modification free SH-groups level of superficial proteins (pHMB affect), mild proteolysis of the superficial nerve proteins (pronase ) and sorption on the nerve alien protein OspA (isolated from Borrelia burgdorferi sensu stricto) on the axon-Shwann cell interactions. ... Aplying Raman spectroscopy we have showed the decrease in the axolemma microviscosity (AM) during binding of free SH-groups and sorbtion of OspA, and the increase in AM under the nerve proteins proteolysis. ...

Еще в разделе: (Показать все результаты (>41) - www.msm.biophys.msu.ru/ )

• MSM 2007

Journal of Cell Science 112, 2277-2289 (1999) Printed in Great Britain © The Company of Biologists Limited 1999 JCS0417 2277 Contribution of plus and minus end pathways to microtubule turnover I. A. Vorobjev1, V. I. Rodionov2, I. V. Maly1 and G. G. Borisy2,* 1Laborator 2Laborator y of Cell Motility, A. N. Belozersky Institute, Moscow State University, Moscow, Russia y of Molecular Biology, University of Wisconsin, 1525 ... Distal (plus) ends of MTs displayed dynamic instability. ...

Еще в разделе: (Показать все результаты (>29) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/jcs.pdf
• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )