... Форумы > Разное > Тема . Автор темы Dr.Neurosurgus . Форумы Список тем Новая тема . ... Publication/Reference Managers . ... чем народ пользуется, чтобы не утонуть в базе ссылок по публикациям по своей теме? . не одними же Reference Manager и ProCite . ... http://forum.khamenya.ru . Ответить Цитировать . ... на сцайнтифике в general форуме . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>104) - www.mmonline.ru/ )

• До 1 ноября Springer предоставляет бесплатный доступ к более чем 150
• MMOnline | Форумы | Разное

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>17) - foroff.phys.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

University Satellites and . Space Science Education . General information Date and Location Objectives of the meeting Sponsoring Organizations International Advisory Committee Local Organizing Committee Deadlines Addresses Hotels & Accommodation Venue Visas Social Programme . First circular . Second circular . ... Abstract Submission List of submitted abstracts . ... The list of abstracts submited . Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6703) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>75) - uneex.mithril.cs.msu.su/ )

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>55) - monkey.belozersky.msu.ru/ )

• S publications
• Homeodomain numeration assumed
• About authors ot this complex

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>253) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"
• Клуб выпускников МГУ: Стивен Бланк. Четыре шага к озарению
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 7-(4-Methylphenyl)cyclopenta[a]quinolizine-10-carbaldehyde Victor B. Rybakov,* Pavel V. Gormay and ... Chemistry, Moscow State University, 119992 Moscow, Russian Federation Correspondence e-mail: rybakov20021@yandex.ru Received 1 October 2010 ; accepted 19 October 2010 ° Key indicators: single-crystal X-ray study; T = 295 K; mean (CґC) = 0.001 A; R factor = 0.024; wR factor = 0.056; ... Acta Cryst. ...

Еще в разделе: (Показать все результаты (>134) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/105e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/121e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/099e.pdf

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>34) - shg.phys.msu.ru/ )

• All Publications Info Pad
• Publications Keywords Search
• List of Publications

... О факультете . Структура факультета . ... Научная работа . ... Коллеги, у Вас есть возможность публиковать научные статьи в Peer-Reviewed Open Access Journals: . Журнал ?Международные научные публикации: Экология и Безопасность (ISP:ES), Том 5, ISSN: 1313-2563 . Журнал ?Международные научные публикации: Материалы, Методы и Технологии (ISP:MMT), Том 5, ISSN: 1313-2539 . ... Д 501.001.20 - все защиты . ... все защиты ? ... Биологический факультет МГУ . ... 2016 Биологический факультет . ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ
• Master In Nanobiotechnology ? Биологический факультет МГУ

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>143) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

... II ? ? Symposium "Big History and Global Evolution" ? : , , , ? ( ) "Big History and Global Evolution" Scientific School for Youth "Historical globalistics: historical evolution, the present and forecast scenarios of global networks, global processes and institutions of global scale, and role of Russia and BRICS" (supported by RSCF) : .. ... 21 ? International Scientific Symposium on Sustainable Development "Global Development: local conflict and challenges during 21st century : .. ...

Еще в разделе: (Показать все результаты (>108) - fgp.msu.ru/ )

• breaking news пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°
• featured post пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°
• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

Schedule : Nonlinearity of Media and Structures, Nonlinear Testing . ... Guyer R. (invited) . ... Esipov I. B. Nonlinear Sound Wave Propagation in 2-D Hysteretic Medium . ... Berndt T. P. Simultaneous Probing of the Nonlinear Effect of a Plane Unbonded Interface on Incident Longitudinal and Shear Acoustic Waves as a Function of Amplitude and Pressure . ... R. E. (invited) . ... Korobov A. I. Influence of Internal Structure of Polycrystalline Copper on Its Nonlinear Elastic and Acoustic Properties . ...

Еще в разделе: (Показать все результаты (>82) - acs366.phys.msu.su/ )

• Abstract
• Schedule : Nonlinear Acoustics and Flows, Instabilities, Turbulence, and
• Schedule : Devices and Industrial Applications of Nonlinear Acoustics

... Terenin IM, Dmitriev SE, Andreev DE, Shatsky IN. 2008) Eukaryotic translation initiation machinery can operate in a bacterial-like mode without eIF2. Nat Struct Mol Biol . ... PubMed ][ PDF ] . ... 2007) Efficient translation initiation directed by the 900-nucleotide-long and GC-rich 5' untranslated region of the human retrotransposon LINE-1 mRNA is strictly cap dependent rather than internal ribosome entry site mediated. ... 2001) Molecular mechanisms of translation initiation in eukaryotes. ...

Еще в разделе: (Показать все результаты (>147) - www.genebee.msu.ru/ )

• List of Publications
• Picornaviruses: discovering big in small

... MTEL-2/RELEC (Telescope T) Instrument: Data Format Current Status . ... BE KNA RELEC . ... PSA-SAS3-Relec instrument, data format current status . ... Radio frequency waves diagnostic on RELEC satellite . ... First results ultraviolet and infrared radiation detector testing on board of the RELEC microsatellite . ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

The Energy Spectrum of Primary Cosmic Rays by the Data of Tunka Cherenkov Array . S.V.Bryanski, Y.V.Vasilchenko, O.A.Gress, T.I.Gress, G.N.Dudkin, A.I.Klimov, V.S.Khlytchieva, L.A.Kuzmichev, B.K.Lubsandorzhiev, E.A.Osipova, V.N.Padalko, L.V.Pan'kov, Yu.A.Parfenov, P.G.Pochil, V.V.Prosin, Yu.A.Semeney . Proc. 24th ICRC, Roma, 1995, v.2, p.724 . The First Results of TUNKA-13 EAS Cherenkov Light Experiment . ... Tunka EAS Cherenkov Array - status 2001 . ... 1) SINP MSU, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>5) - dbserv.sinp.msu.ru/ )

... October, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... You will not only learn Russian for your professional career, but also learn a lot about Russia and its people that will allow you to communicate with your Russian clients more efficiently. www.rlcentre.com . ... Europalia International welcomes the biggest country in the world to a new edition of its multidisciplinary and edifying festival. ...

Еще в разделе: (Показать все результаты (>11) - www.rlcentre.com/ )

... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...

Еще в разделе: (Показать все результаты (>4) - music.genebee.msu.su/ )

• MSU Chamber Orchestra. Concerts. Season 2001/2002.