... Email . ... Department of Chemical and environment engineering, Gubkin Russian State University of Oil and Gas, 2012 . ... Department of Chemistry, Lomonosov Moscow State University, Leninskie gory 1/3, Moscow 119991 Russia . ... 7 (495) 939-3557 . ... 7 (495) 939-0290 . ... medicinal chemistry, chemoinformatics, QSAR, computer-aided drug design, molecular modeling, docking, virtual screening . ... Sosnina, Ekaterina A. Home . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>21) - qsar.chem.msu.ru/ )

• Home - Laboratory of Medicinal Chemistry
• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry
• Orlov, Alexey A. - Laboratory of Medicinal Chemistry

Nicholas Rescher (Philosophy; Ph.D., Princeton; logic, philosophy of science, history of philosophy; Aristotle; Arabic philosophy) is University Professor of Philosophy. He came to the University in 1961, has served as chairman of the department, and is vice chairman of the Center for Philosophy of Science. ... In 1989-90 he served as president of the American Philosophical Association (Eastern Division). From 1969 to 1993 he edited the American Philosophical Quarterly . ...

Еще в разделе: (Показать все результаты (>483) - chronos.msu.ru/ )

• Электронные библиотеки мира

. Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services . Partners . Links . Contacts . About . Team . Publications . Russian Pages . CDFE => About => Statistics . All visits . Visits without robots . Visits outside CDFE Statistics refresh once a day. [ Online Services | Partners | About | Team | Publications | Contacts | Links | Russian ] . If you have any questions, comments, and/or suggestions, please, contact . CDFE Head: Vladimir V. Varlamov . CDFE, 2003.

Еще в разделе: (Показать все результаты (>46) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Team
• CDFE => Useful links

Regulation of cytochrome c peroxidase activity by nitric oxide and laser irradiation Osipov A.N., Stepanov G.O., Vladimirov Yu.A. , Kagan V.E. 1 2 Department of Medical Biophysics, Russian State Medical University, ul. ... This decomposition led to restoration of cytochrome c peroxidase activity. Finally, it can be concluded that nitric oxide and laser irradiation may serve as effective instruments for regulating the peroxidase activity of cytochrome c, and, probably, apoptosis. ...

Еще в разделе: (Показать все результаты (>106) - www.msm.biophys.msu.ru/ )

• http://www.msm.biophys.msu.ru/archive/doc14948/eng.pdf
• MSM 2007

trendence Graduate Barometer Europe 2011 About the survey ­ About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...

Еще в разделе: (Показать все результаты (>4) - studsov.math.msu.su/ )

... BUSINESS ADDRESSES: Physics Department, Moscow State University, . ... Research Assistant, Department of Chemistry, Moscow State University, 1971-1972 . ... Research Associate, Physics Department, Moscow State University, 1972-1984 . ... Senior Scientist, Physics Department, Moscow State University, 1984-1991 . ... Associate Professor, Physics Department, Moscow State University, 1991-2002 . ... Professor, Physics Department, Moscow State University, Since 2002 – present HONORS and PRIZES . ...

Еще в разделе: (Показать все результаты (>43) - shg.phys.msu.ru/ )

• Intro
• TATIANA VLADIMIROVNA MURZINA
• Nick's Homepage

... School of Public Administration . Lomonosov Moscow State University . ... Moderator: Prof. V.A.Nikonov, Dean, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. A.I. Solovyov, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. A.V. Surin, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. V.G. Koshkidko, School of Public Administration, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>83) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/mejdunarodnaja_letnjaja_shkola_povishenija_kvalifikazii_prepodavatelei/6_shkola.pdf
• Список полнотекстовых баз данных
• Visa Support Information

Next: The Internet Protocol Up: TCP/IP Networks Previous: Ethernets . In larger installations, such as Groucho Marx University, Ethernet is usually not the only type of equipment used. At Groucho Marx University, each department's LAN is linked to the campus backbone, which is a fiber optics cable running FDDI ( Fiber Distributed Data Interface ). ... For long-distance network links, a different type of equipment is frequently used, which is based on a standard named X.25. ...

Еще в разделе: (Показать все результаты (>453) - itpm.msu.su/ )

• Enter DNS
• ITPM MSU Web Page
• Links

.

Еще в разделе: (Показать все результаты (>34) - mailybaev.imec.msu.ru/ )

• Dr Alexei A. Mailybaev
• Multiparameter Stability Theory with Mechanical Applications

... Russian . ... PhD ( Phys ), 2000, Kursk State Technical University. ... Student at Kursk State Pedagogical University, Physics and Mathematics Faculty, diploma project in Magnetoacoustics, Theoretical Physics Department. ... Assistant at the Theoretical Physics Department of Kursk State Pedagogical University. ... Head of the Theoretical Physics Department of the Research Center for Condensed Matter Physics and Associate Professor at the General Physics Department, Kursk State University. ...

Еще в разделе: (Показать все результаты (>82) - chaos.phys.msu.ru/ )

• Staff
• Dzhanoev's home page
• Alexey Ryabov

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Gas Sensors Laboratory (SENSOR) , Department of Chemistry and Physics for Engineering and for Materials , University of Brescia , Italy: Prof. Giorgio Sberveglieri, Guido Faglia, Maurizio Artoni, Camilla Baratto, Dario Zappa. Lab contact Prof. Alexander Gaskov. ... Laboratory contact person: Dr. S.G. Dorofeev . ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>25) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods
• Nhunt: program for nucleic acid sequence similarity search

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>20) - anazarenko.ffl.msu.ru/ )

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>25) - dbserv.sinp.msu.ru/ )

• The Other BAFIZ Pages
• BAFIZ at SINP MSU
• Information Resources at SINP MSU

Moscow State Lomonosov University and Moscow Mathematical Society . are organizing International Conference . Topology, analysis and applications to mathematical physics" . ... The conference will be held in Moscow from February 14 to February 19, 2005 . ... Geometry and topology, analysis, applications to mathematical physics . ... Moscow Mathematical Society, . ... Seminar on Topology and Analysis . ... e-mail: soloconf@mech.math.msu.su . ... Date of birth: . ... E-mail: . ...

Еще в разделе: (Показать все результаты (>46) - dfgm.math.msu.su/ )

• 2nd Announcement
• Intro

CURRICULUM VITAE Nataliya V. Roznyatovskaya, Ph.D. Moscow State University Chemical Faculty, Department of Electrochemistry Vorob'evy Gory, MSU, 119992 Moscow Russia Tel: +7(495)-939-25-70, Fax: +7(495)-932-88-46 E-mail: natasha@elch.chem. msu.ru www. elch.chem. msu.ru/~natasha/ Personal: Born: December 27, 1979 (Moscow) Citizenship: Russian Family state: unmarried Education: 2002 Diploma in Chemistry from Moscow State University, Chemical Faculty, Department of Chemical Enzymology. ...

Еще в разделе: (Показать все результаты (>94) - electr003.chem.msu.ru/ )

• Evgeny V. Antipov:CV
• Victor A. Safonov:CV
• Jurii M.Maksimov:CV

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>13) - www.phys.msu.ru/ )

• online journals
• Faculty Staff
• Library of the Faculty of Physics

... 1967-1972: Undergraduate: M.V. Lomonosov Moscow State University, Department ofТљMechanics and Mathematics. ... 1980-1987: The Deputy Dean for science and research, Department ofТљMechanics and Mathematics, M.V. Lomonosov Moscow State University . ... 1997-2001: The Deputy Minister ofТљthe Education ofТљthe Russian Federation . ... since 2003: Head ofТљDepartment ofТљMechanics, Steklov Mathematical Institute, Russian Academy ofТљSciences . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>134) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Conferences - Sixth International Conference
• Institute of Computer Sciences - Staff

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . COLLABORATION .

Еще в разделе: (Показать все результаты (>3) - vernov-relec.sinp.msu.ru/ )