. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>11) - top.sinp.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

Еще в разделе: (Показать все результаты (>3) - vernov-relec.sinp.msu.ru/ )

... On Wednesday, July 3rd, the Faculty of Physics will conduct a seminar (room H8) where we will discuss the following topics? ... 1) MEMS technology. ... MEMS circuits that are currently made. ... 2) Renesas microcontrollers. ... 4) Power source circuits ST (AC-DC). ...

Еще в разделе: (Показать все результаты (>24) - engineering.phys.msu.ru/ )

• Rotor Engines on Permanent Magnets, Principles of Their Control and Modern
• Introduction to Linux

... Котин В.В., Ершов Ю. А. (Москва) . ... Модифицированный вариант открытой экотоксикологической модели [1,2] позволяет исследовать динамику популяций под влиянием импульсного воздействия токсикантов. ... Система 'популяция-токсикант' описывается на макроуровне как открытая неавтономная динамическая система, эволюционирующая в медленном времени [3,5]. ... Ершов Ю.А., Котин В.В. Журнал физической химии, 2000 , т. 7 4 , ? ... Ершов Ю.А., Котин В.В. Научная сессия МИФИ-2000. ... М., МИФИ, 2000, с.117-118....

Еще в разделе: (Показать все результаты (>44) - www.library.biophys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Еще в разделе: (Показать все результаты (>25) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Midterm_test.pdf
• http://www.eng.math.msu.su/download/Academic_English_part2.pdf
• http://www.eng.math.msu.su/download/Academic_English_part1.pdf

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . Главная . ... О МЛЦ МГУ . ... Setup for material analysis by laser ablation spectroscopy . ... Главная Cотрудничество ILC of Bratislava ILCB laboratories Laboratory of Material Analysis Setup for material analysis by laser ablation spectroscopy . In addition to laser processing, the setup, containing pulse laser and vacuum chamber, allows direct analysis of the composition of materials. ... 2008 МЛЦ МГУ . ...

Еще в разделе: (Показать все результаты (>82) - ilc.phys.msu.ru/ )

• Grant detail
• Laboratory of Material Analysis
• Грант подробно

... A nonlinear model that describes the interaction of a rigid body with a medium and takes into account (based on experimental data on the motion of circular cylinders in water) the dependence of the arm of the force on the normalized angular velocity of the body and the dependence of the moment of the force on the angle of attack is constructed. ... The present paper is the next stage in the study of a moving rigid body interacting with the medium only by the flat front area (plate). ...

Еще в разделе: (Показать все результаты (>46) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-98-1.pdf
• http://shamolin2.imec.msu.ru/art-112.pdf
• http://shamolin2.imec.msu.ru/art-160-1.pdf

: «SAP HANA ­ the main memory database platform for modern hardware» «SAP HANA ­ » 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) ­ , . «in-memory» SAP . , SAP HANA «in-memory» , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68

Еще в разделе: (Показать все результаты (>4) - master.cmc.msu.ru/ )

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>17) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>45) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/weinstein09.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/dd03proc.pdf

Lab . Main page News People . ASA . Master . Master net Homepage . ... Lomonosov Moscow State University Sternberg Astronomical Institute . ... MASTER . ... Lomonosov (ShOK) . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . People, who work in lab . Latest news and news archive . ... Short Bright MASTER OT114444.53 +323011.3 detection and 6-m telescope follow up deep image ATel3823 . ... All news ...

Еще в разделе: (Показать все результаты (>27) - master.sai.msu.ru/ )

• Conference program
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

... QUANTUM INFORMATION AND COMPUTATION Absolute Robustness of the First Principal Fourier State Component and Noise Suppression in Hilbert Space Yu. ... 2, Moscow, 119992 Russia e-mail: skulik@qopt.phys.msu.su Received March 28, 2006 Abstract--The effect of the absolute robustness of the first principal Fourier-state component is developed upon rounding off the density matrix elements. ... This is interpreted as the absolute robustness of the first principal component of the Fourier state density...

Еще в разделе: (Показать все результаты (>85) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• http://qi.phys.msu.ru/papers/2010-prl-105-010404.pdf
• http://qi.phys.msu.su/papers/2007-os(e)-103-107.pdf

Programs of General Courses . ... Instrumenta Studiorum . Historical Education Programs of General Courses . ... The handbook of programs of general courses is composed for students of the historical faculty of Moscow State University. ... 1st Course: . ... Contemporary History of Europe and America, History of Southern and Western Slavs (6th century - late 20th century), Methodological Problems of Historical Research, Foreign Languages. 5th Course: . ... Copyright 1999--MSU History Faculty ...

Еще в разделе: (Показать все результаты (>12) - www.hist.msu.ru/ )

• Library systems

... This area of ??the program is devoted to the study of the biological diversity of animals in various aspects. We study the taxonomic (mainly species) diversity 9 in types, at least 14 classes and at least 30 orders of multicellular animals. Research is conducted at two levels of diversity - global (family-to-type macrotaxa rank analysis according to the world fauna level) and local (subspecies-to genus taxa rank analysis as a part of the regional fauna and local natural communities). ...

Еще в разделе: (Показать все результаты (>5) - depository.msu.ru/ )

• Biological information | depozitariy

The Abdus Salam International Centre for Theoretical Physics www. ictp .it United Nations Educational, Scientific and Cultural Organization IAEA Workshop on Nuclear Data for Science and Technology: Medical Applications 30 September - 4 October 2013 Miramare - Trieste, Italy The Abdus Salam International Centre for Theoretical Physics ( ICTP , Trieste, Italy) in cooperation with the ... There is no registration fee for attending the Workshop. ...

Еще в разделе: (Показать все результаты (>208) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/63a/ic-cmtp3%20First%20Circular1-2.pdf
• Title
• SAMSUNG EDUCATIONAL PROGRAMS

... Lomonosov Moscow State Univ Research Center "Computer Science and Control" of RAS (FRC CSC RAS) Operations Research Society (RSORS) will organize the VIII Conference in Octo Operations Research. theoretical aspects and ersity (MSU), Federal and Russian Scientific ber 2016 in Moscow. ... Deadline for abstract submissions is March 31, 2016. ... Conference website: http://io.cs.msu.ru/ORM2016.html. ... Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>21) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2016/ORM2016-2nd_announ-ENG.pdf
• http://io.cs.msu.ru/translation2.pdf
• http://io.cs.msu.ru/ORM2013/ORM2013-2nd_ann-ENG.pdf

... Is it necessary to do the beam weaker? ... Q: If the mixture of powders consists of both isotropic and anisotropic particles, is it possible to estimate the ratio of isotropic and anisotropic parts? If I understand the question correctly, one asks, if one has a fraction of oriented anisotropic particles and a fraction of the disoriented anisotrpic particles (i.e. one has somewhat partial texture in the powder sample), then is it possible to find out these fractions? ...

Еще в разделе: (Показать все результаты (>22) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry
• Laboratory of Electrochemical energetics