Fluctuation in EAS development and estimates of energy and composition of the primary radiation by L. Dedenko, SINP, MSU 1) surface scintillation detectors (SD) 2) detectors of the Vavilov-Cherenkov radiation (VCR) 3) underground detectors of muons (UD) (with the threshold energy ~1 GeV). Yakutsk array Detectors readings · The various particles · of Extensive Air Showers (EAS) · at the observation level · hit detectors · and induce some signals sampled as · detector readings 18.05.2011. IWS. ...

Еще в разделе: (Показать все результаты (>7) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/Shpiering.pdf

... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...

Еще в разделе: (Показать все результаты (>3) - vernov-relec.sinp.msu.ru/ )

MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...

Еще в разделе: (Показать все результаты (>10) - astrometric.sai.msu.ru/ )

• Семинар по гравитации и космологии имени А.Л.Зельманова
• Symbolic circuit processor

Pleistocene Chronology and Climatology Based on Grainsize Analysis of a Classic Loess Sequence (China) . ... It is shown that the grainsize characteristics of the loess sequence at Luochuan on the Chinese Loess Plateau are a direct function of climate. ... Grainsize boundaries in the vertical section coincide with known climatic changes for the youngest 250 ka. Given the absolute ages of these boundaries allows to determine sedimentation ratios of the loess. ... Back to the Abstracts list ...

Еще в разделе: (Показать все результаты (>81) - www.fadr.msu.ru/ )

• SPECIAL ISSUE OF CATENA «RECONSTRUCTION AND CLIMATIC IMPLICATIONS OF PALEOSOLS»

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>31) - eng.geogr.msu.ru/ )

• Department of Cryolithology and Glaciology

... Форумы > Разное > Тема . ... Форумы Список тем Новая тема . ... Требуется Web - дизайнер. В крупную компанию для переделки существующего и поддержки нового сайта требуется дизайнер. ... Ответить Цитировать . ... web . Web-дизайнер и web-программист действительно две разных профессии. ... Lie groups and Lie algebras - Calculations on computers, . ... Machinery, Working place, Engineering work, Workspace, . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>35) - www.mmonline.ru/ )

• MMOnline | Новости | Заседание Московского Математического Общества 11 октября
• Заседание Московского Математического Общества 11 октября 2005 г.

... Air temperature in the forechamber: 285-295K . ... Aerodynamic unit AR-2 is used for experimental research of heat and mass exchange processes in a model boundary layer, flown over by supersonic air stream. The main part of the unit is supersonic aerodynamic tube of continuous action with regulated plate nozzle, rectangular cross-section of the working part 100x70 and with regulated exit cone. ... Unit AR-2 is a supersonic aerodynamic tube with a regulated supersonic nozzle and an exit cone. ...

Еще в разделе: (Показать все результаты (>5) - termogaz.imec.msu.ru/ )

In Silico Biology 3 (2003) 197­204 IOS Press 197 The Channel in Transporters is Formed by Residues That Are Rare in Transmembrane Helices Olga V. Kalinina1,*, Vsevolod J. Makeev1, Roman A. Sutormin1, Mikhail S. Gelfand1,2 and Aleksandra B. Rakhmaninova2 1 2 State Scientific Many genes encoding known or putative transport proteins are found in bacterial genomes. ... It is based on the analysis of amino acids frequencies in bacterial secondary transporters. ... Proteins 51, 85­95. ...

Еще в разделе: (Показать все результаты (>7) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/batmas30.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/genome_biol_evol_2014.pdf

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>8) - top.sinp.msu.ru/ )

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>3) - hep.phys.msu.ru/ )

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>5) - innovation.msu.ru/ )

... In this poster I give special emphasis for the Balmer-line emission and H2O circumstellar masers, for which we have traced a long-term variability. ... The H2 O masers from both groups flare from time to time. ... 2 3 A Low-Mass Companion as a Source of Sho cks As a basis of a discussion, I propose another explanation for the lack of radio continuum and for the rare H­H2O episodes in the `transient' H2O source, namely, impact of a shock provoked by a low-mass companion (a planet?) to the Mira star. ...

Еще в разделе: (Показать все результаты (>23) - comet.sai.msu.ru/ )

• http://comet.sai.msu.ru/~gmr/AC/AC1596.pdf
• Dm. Bizyaev's Publications
• Multiwavelength Study of Mira Ceti-Type Variable Stars

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• StructAlign help

... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

• About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Новости для выпускников . МГУ им.Ломоносова . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Создан метод, позволяющий определить возраст человека по его слюне . ... Генетики из Университета Калифорнии нашли способ определять возраст человека. ... Их новый метод тестирования способен перевернуть криминалистику и помочь определять точно возраст преступника, констатируют эксперты. ... Self-conscious about your age? ...

Еще в разделе: (Показать все результаты (>121) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: AGEING Dr.Sula - General Overview 2008
• Клуб выпускников МГУ: Три тысячи продуктов для продления молодости
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC

. [ Войти ] . Главная -> Фильмы -> The Matrix Recalibrated . Пользователи . Демо . Деньги . Фильмы . Форум . The Matrix Recalibrated . США 2004 . отметить . Документальный .

Еще в разделе: (Показать все результаты (>12) - kinfo.ru/ )

... It was necessary to construct quite a different type of parachute to be light, compact, encased in a parapack and reliable. At first most parachute designers considered it to be hardly possible for a canopy to open in the air without the aid of some special devices, such as an umbrella spokes, compressed air or powder explosive charges. ... Later on a great number of different parachute systems were worked out and introduced by Russian parachute designers Nikolai Lobanov, Igor Glushkov and others. ...

Еще в разделе: (Показать все результаты (>5) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations

... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>3) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши