New photos are on my new site: photo777.org . ... photo . ... Pentax K20D . smc Pentax DA 18-55mm 3.5-5.6 II . smc PENTAX-FA 50mm F1.4 . Submitted by pyotr777 on Wed, 09/11/2011 - 15:01 . ... Hamburg photo gallery. June 3, 2010. ... Hamburg . ... Submitted by pyotr777 on Sun, 13/06/2010 - 18:06 . ... Submitted by pyotr777 on Sat, 12/06/2010 - 00:29 . ... May 29 - June 2, 2010. ... Submitted by pyotr777 on Tue, 08/06/2010 - 23:32 . ... Submitted by pyotr777 on Fri, 28/05/2010 - 10:40 . ...
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
. General Information . Media Files . Participants . Timetable . Local Information . Photos . We have added a photo gallery ( http://site2010.sai.msu.ru/photo ). It contains some pictures with area around ASM of SAI, Kislovodsk and several sigths. The gallery will being enlarged.
... Main Discography . Studio Albums . ... CD Singles . ... Joe Satriani . ... The Essential Deep Purple Survival Kit . ... Deep Purple Tribute Albums . ... The Highway Star's Deep Purple Discography seeks to cover all, or at least most, official releases. ... Joe Cath <joecath(at)aol.com> . ... Rasmus Heide <rasmus(at)deep-purple.com> . ... Benny Holmstr?m <benny(at)deep-purple.com> . ... Ed Janx <edjanx(at)deep-purple.com> . ... Stathis Panagiotopoulos <span(at)deep-purple.com> . ... Deep Purple ! ...
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Publications . ... Number of publications 0 . ... Borisov A. V. , Kazakov A. O. , Kuznetsov S. P. Nonlinear dynamics of the rattleback: a nonholonomic model . ... A number of strange attractors are considered, for which phase portraits, Lyapunov exponents, and Fourier spectra are presented. ... Borisov A. V., Kazakov A. O., Kuznetsov S. P., Nonlinear dynamics of the rattleback: a nonholonomic model , Physics-Uspekhi, 2014, vol. 184, no. 5, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 ....
... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...
... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Generation of Polarization Entangled States in Spatially Inhomogeneous Ferroelectrics?, Advanced Science Letters, 2 (4), 430?447 (2009). ... Download [ help ]: . ... Copyright notice: This material is presented to ensure timely dissemination of scholarly and technical work. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...
QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...
[
Текст
]
Ссылки http://qilab.phys.msu.ru/people/grishanin/teaching/program.pdf -- 12.1 Кб -- 04.02.2008 Похожие документы
Solar proton anisotropy and dropout effects in the polar cap and auroral zone during period of the extended substorm activity Kuznetsov S.N., and Lazutin L.L. Institute of Nuclear Physics, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia Abstract. ... Dropout effects of the proton radial distribution were found suggesting specific field line stretching inside the magneosphere trapping region during period of extended substorm activity. ... Fig 1. ...
[
Текст
]
Ссылки http://www.kosmofizika.ru/pdf2/apatyty07_proton_dropouts.doc -- 860.5 Кб -- 03.06.2008 Похожие документы
ЭЛЕКТРОСТАТИЧЕСКИЕ СВОЙСТВА ПРОМОТОРНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ E.COLI И РАННИХ ОБЛАСТЕЙ ГЕНОМОВ ФАГОВ Т4 И Т7 . ... Рассчитан профиль распределения электростатического потенциала вокруг полной последовательности хромосомы E.coli, а также 359 фрагментов ДНК длиной 400п.н., содер-жащих промоторы E.coli, обозначенные на хромосоме как экспериментально подтвержденные, и промоторы ранних генов фагов Т7 и Т4. Проведен анализ особенностей электро-статических свойств промоторных и непромоторных областей ДНК. ...
... Вакансии . ... Ярмарки вакансий и выставки . ... Technical Requirements Analysis (Functional Decomposition and Call Flows). Provide Business Requirement Specifications, Software Requirement Specifications, and Product Feature Descriptions. ... Substantial experience in requirement analysis and requirement management. ... In order to expand the development of our product globally, jNetX is currently looking for a Requirement Analyst to Product Management Department, based in Moscow. ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
. HOME . MSU Chamber Orchestra . ИМЕЕТСЯ РУССКАЯ ВЕРСИЯ . The Musical Workshop . of Edward Gindin . To see Edward Gindin's painting, . visit his gallery .
Эксперимент СФЕРА SPHERE еxperiment . Официальный сайт эксперимента . ... English . Эксперимент СФЕРА . ... Физика . ... 2011 год . 2012 год . ... Институт ядерных исследований РАН . ... Научно-исследовательский институт прикладной физики ИГУ . Научно-исследовательский институт ядерной физики имени Д.В. Скобельцына . Физический институт имени П.Н.Лебедева Российской академии наук (ФИАН) . ... RSS Записей . RSS Комментариев . ...