Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>32) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/koesite.pdf
• http://cryst.geol.msu.ru/links/
• http://cryst.geol.msu.ru/literature/lit_aks.php

... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>79) - en.cs.msu.ru/ )

• Department of Automation for Scientific Research | CMC MSU
• Research Laboratory of Computational Modeling Tools
• Department of Automation for Scientific Research

... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...

Еще в разделе: (Показать все результаты (>46) - eng.geogr.msu.ru/ )

• Khibiny teaching and research station
• Geoecology of the Northern Territories
• Department of Oceanology

О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>3) - geo.phys.msu.ru/ )

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>9) - nano.msu.ru/ )

On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...

Еще в разделе: (Показать все результаты (>16) - www.rochesterastronomy.org/ )

• Supernova 2002bl in UGC 5499

... Each of the nanodisks exhibits both electric and magnetic Mie-type resonances that are shown to affect significantly the nonlinear response. We observe the thirdharmonic radiation intensity that is comparable to that of a bulk silicon slab and demonstrate a pronounced reshaping of the third-harmonic spectra due to interference of the nonlinearly generated waves augmented by an interplay between the electric and the magnetic dipolar resonances. ...

Еще в разделе: (Показать все результаты (>55) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/apl97_261908_2010.pdf
• http://nanolab.phys.msu.ru/sites/default/files/apl94_231122_2009.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jetplett103_46_2016.pdf

... Publications . ... Number of publications 0 . ... Borisov A. V. , Kazakov A. O. , Kuznetsov S. P. Nonlinear dynamics of the rattleback: a nonholonomic model . ... A number of strange attractors are considered, for which phase portraits, Lyapunov exponents, and Fourier spectra are presented. ... Borisov A. V., Kazakov A. O., Kuznetsov S. P., Nonlinear dynamics of the rattleback: a nonholonomic model , Physics-Uspekhi, 2014, vol. 184, no. 5, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 ....

Еще в разделе: (Показать все результаты (>86) - ics.org.ru/ )

Lomonosov Moscow State University Biological faculty Botanical garden (Russia, http://botsad.msu.ru) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The first information letter Dear colleagues! ... Wide range of topics concerning representatives of genus Iris L. are planned to be discussed at the following sections: 1. ... Abstract submission deadline is Apr.1, 2011. ... Rodionenko G.I. Genus Iris. ...

Еще в разделе: (Показать все результаты (>6) - botsad.msu.ru/ )

• http://www.botsad.msu.ru/docs/eng_iris2.doc

The VLT Survey Telescope: a year after its coming into operation Massimo Capaccioli Department of Physics, University of Naples Federico II National Institute of Astrophysics - VST center at Naples The VLT Survey Telescope (VST) is a 2.6 m wide field optical telescope located at the Cerro Paranal Observatory of ESO in the Chilean Andes. ... The wide field is sampled by OmegaCam, a camera with a mosaic of 32 CCD for a total of 256 Mpixels, provided by the homonymous consortium. ...

Еще в разделе: (Показать все результаты (>12) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Study and Research . ... MSU Online . ... Research Priorities in the Humanities at MSU: . Faculty of History . ... History of Moscow State University . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ... Innovative technologies in teaching social-economic disciplines and the humanities in universities . ...

Еще в разделе: (Показать все результаты (>74) - www.msu.ru/ )

• Faculty of Soil Science
• Faculty of History
• FACULTY OF FOREIGN LANGUAGES

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...

Еще в разделе: (Показать все результаты (>3) - silab.sinp.msu.ru/ )

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>22) - suny.msu.ru/ )

• Центр по делам России и США :: Другие проекты в России
• Center on Russia and the United States :: About us
• Center on Russia and the United States :: News Archive

The Department of Talented Youth Affairs and Professional Orientation . ... Projects . ... From 1 to 6 July 2014 there were held the third championship of the ?SanSat in Russia? which took place in Dubna (Moscow) ? ... CanSat is a model of microsatellite weighing about 350 grams. CanSat project started in 1999. ... Participants at the third championship were offered a large educational and excursion programs. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>54) - talant.msu.ru/ )

• The All-Russian National History test | The Department of Talented Youth
• MSU CNIR visited the Republic of Korea in the delegation of ?Sport
• National intellectual development Fund paid trips to summer school | The

... Repertoire . ... The Early Music Theatre is an amateur studio. ... The Theatre's repertoire is based on the music of both Russian and European composers of 16th-18th centuries: "L'Amfiparnaso" - a madrigal comedy by O.Vecchi (Italy, XVI), belonging to comedy dell'arte genre, "The English Debute" - musical competition between British early 'elite Art' ("Fairy Queen" by H.Purcell, late 17th cent.) and contemporary 'vulgar' musical amusements ("Beggar's Opera" by J.Pepush, early 18th cent.) ...

Еще в разделе: (Показать все результаты (>7) - www.tsm-msu.ru/ )

... 24 months to develop your career in Finance and Marketing Departments in British American Tobacco; . ... We are looking for high calibre graduates to join a truly FAST -TRACK Management Trainee Programme. ... In Russia, Management Trainee programme exists since 1996, so we have a great pool both of experienced coaches and successful programme graduates. ... You can also read more about Finance, Marketing functions, Management Trainee Program itself, Selection Process on this microsite. ...

Еще в разделе: (Показать все результаты (>31) - www.physcareer.ru/ )

• Software Requirements Analyst / Вакансии / Physcareer.ru
• Конкурс грантов для молодых исследователей National Geografic / Гранты и

... Новости . ... Наука . ... Все новости . ... Paper of the Week in Physica Scripta by Prof. A. Zheltikov . ... Главная Новости Сотрудничество . ... See Agenda of the visit on the next page. ... Taiwan side: . ... Prof. Keiser . Prof. Liaw . Prof. Hsu . ... Prof. Makarov . ... Prof. Priezzhev . ... 2:00 Arrive at the International Laser Center . ... 3:40-4:10 General visiting of Int. Laser Center (Prof. Makarov's laboratory and Laser Teaching Lab, Dr. Golovnin) (Prof. Makarov) . ...

Еще в разделе: (Показать все результаты (>97) - ilc.phys.msu.ru/ )

• Setup for high-resolution luminescence spectroscopy

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...