... Scientific goals . ... Magnetospheric particles and radiation conditions . Automatic gaze stabilization corrector . Scientific equipment . ... An automatic gaze stabilization corrector can give an example. This device allows to improve the quality of the cosmonaut?s visual control of the moving objectsљ under the conditions of microgravity. This device must compensate the signal developed by the vestibular system of the cosmonaut. ... an automatic gaze stabilization corrector. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• Scientific equipment | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>57) - new.math.msu.su/ )

• Официальный сайт механико-математического факультета МГУ имени М.В.Ломоносова
• Vestnik Moskovskogo Universiteta. Matematika, Mekhanika

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>46) - eng.geogr.msu.ru/ )

• Faculty of geography Lomonosov Moscow State University
• Science

... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б  . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>16) - ecfs.msu.ru/ )

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1548) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>18) - suny.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>12) - iconolat13.phys.msu.ru/ )

• Proceedings

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>8) - asa.guru.ru/ )

• Alexander Antonov's Resume

University Satellites and . Space Science Education . ... Aerospace and remote sensing education in the Geography schools of Moscow and Cambridge universities . ... The two well-known universities under comparison, namely the Lomonosov Moscow State University, and the University of Cambridge, UK have well established traditions of geographical remote sensing. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>98) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

... Staff . ... Director ofТљPhysical Mathematical Sciences . Director ofТљthe Institute ofТљComputer Science . ... mamaev@rcd.ru . ... since 2002: Deputy director of Institute of Computer Science . ... Associate editor of International Scientific Journal "Regular and Chaotic Dynamics"; editor-in-chief of Russian journal "Nelineinaya Dinamika" (Nonlinear Dynamics); managing editor of "Quantum Computing and Computations". ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>216) - ics.org.ru/ )

• Institute of Computer Sciences - Publications
• Institute of Computer Sciences - Contacts
• Institute of Computer Sciences - Journals

... A t the Faculty of Physics, the undergraduates during first five semesters receive basic education, which includes courses and practicums on general physics, mathematics, programming, and other subjects. ... At this point, the students are assigned to the different chairs, and, along with the general courses they receive some specialized training within the frame of scientific research conducted at the specific chair. ... Offered diploma in Physics and Astronomy . ... Courses on choice (2 courses). ...

Еще в разделе: (Показать все результаты (>26) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)
• Useful Information

SITE 2010 Comprehensive Characterization of Astronomical Sites Kislovodsk, Russia, 49 October 2010 Conference Summary Marc S. Sarazin*a a European Southern Observatory, Garching, Germany Abstract The main topics discussed during the Site 2010 conference are outlined and the outcome is described. Keywords: Astronomical Site testing, precipitable water vapor, atmospheric turbulence, cloudiness, seeing 1. ... Site surveys for National observatory projects in China, India, and Iran benefit from this. ...

Еще в разделе: (Показать все результаты (>22) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/TTravouillon_TMT_site_testing_site2010.pdf
• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf
• Methods and instruments to measure/monitor major site properties

... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...

155. http://master.cmc.msu.ru/files/computer_architecture.pdf

156. http://kcor.sai.msu.ru/arXiv1002.2360.pdf

157. Links

158. http://www.fbm.msu.ru/upload/news/2012/12-05/progr.doc

159. http://fpga.parallel.ru/papers/gudkov.pdf

160. Вычислительные библиотеки, использующие ГПУ