... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

Dear Colleagues, As you know, JENAM-2007 will take place in Yerevan, Armenia. ... JENAM-2007 will consist of 6 Plenary sessions (invited reviews on hot topics of modern astrophysics, 8 EAS Symposia, and 7 Special Sessions (SPS). ... The opening and closing sessions, EAS symposia and special sessions will be organized in the conference halls and auditoria of the Yerevan State University (YSU). ... The proceedings of the JENAM-2007 will be published in the EAS proceedings series in 2008. ...

Еще в разделе: (Показать все результаты (>96) - sai.msu.ru/ )

• General Catalogue of Variable Stars: What's new.
• General Catalogue of Variable Stars: Description
• GCVS Research Group: History and Persons.

... The Art of Computer Programming . Association for Computing Machinery (ACM) - Turing Award . ... California Institute of Technology . ... Computers: History and Development . Computer Musing . ... Digital Typography . ... History of Computing - IBM 650 . ... Don Knuth's Home Page . Knuth: Digital Typography . Donald Knuth wins Kyoto Prize . Literate Programming Library . ... Softpro Books - Art of Programming . ... Westinghouse Science Honors Institute . ...

Еще в разделе: (Показать все результаты (>412) - www.nature.web.ru/ )

• Theoretical Computer Science: взгляд математика
• Международный семинар "Optics in computing"

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>19) - imk.msu.ru/ )

UGENE toolkit: Bioinformatics "Swiss army knife" Yuriy Vaskin Novosibirsk State University, Novosibirsk, Pirogova St. 2, 630090, vaskin90@gmail.com M. Fursov NCIT Unipro, Novosibirsk, Lavrentieva ave. 6/1, 630090, mfursov@unipro.ru In the age of information technologies it is not surprising that biologists use special computer programs in their day-to-day work. ... Currently there are a lot of data formats and types which are spread throug various biological databases. ...

Еще в разделе: (Показать все результаты (>212) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/52.pdf
• MCCMB'07

... Funds/Grants Page at Moscow State University [In Russian] . ... Physics Journals . ... Information for authors . ... Laser Physics (MAIK NAUKA) . ... Quantum Electronics . ... Quantum Optics, Quantum Information, and Quantum Computing . ... European Research Network--The Physics of Quantum Information . ... Quantum Information Processing National Project (Germany) . Quantum Imaging Lab, Boston University . ... Institute for Quantum Information (Caltech) . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>85) - qilab.phys.msu.ru/ )

Aleksanteri Institute Visiting Scholars Programme Aleksanteri Visiting Fellowships 2013 ґ2014 THE FELLOWSHIP Is intended for scholars who hold a PhD degree in a field relevant to the Aleksanteri Institute 's research agenda and whose place of residence i s outside of Finland Is for a period of two to three months between August 2013 and June 2014 Involves a research stay at the Aleksanteri ... An electronic application form 2. ... The applications are evaluated by three experts. ...

Еще в разделе: (Показать все результаты (>89) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Aleksanteri_Visiting_Fellowships_2011-2012.pdf
• Электронные библиотеки и ресурсы | Высшая школа бизнеса МГУ им. Ломоносова

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>11) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~ifed/teraflops/Popova_OpenMP.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>76) - scon155.phys.msu.su/ )

• Off-centering of Pb and Sn impurities in GeTe

... This lack of information is primarily due to technical difficulties in the monitoring of Cl in biological organisms. ... This restricts the duration of the measurements and allows only a very low data acquisition rate. 160 mM), which is relatively far from physiological range of Cl in mammalian nervous system (5-30 mM). Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ... Biological fac., ...

Еще в разделе: (Показать все результаты (>79) - www.msm.biophys.msu.ru/ )

• Registration and Fee
• Files

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>84) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Geometric methods in optimal control theory | Department: General Problems of

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... On October, 2014 February 2015 the students of the Faculty of Journalism, MSU were studying at  Humboldt University of Berlin . ... Representatives of German party have repeatedly participated in educational programs organized by the Faculty of Journalism and the lecturers of the partner university are the regular guests of the house on the Mokhovaya street.  ...

Еще в разделе: (Показать все результаты (>94) - www.journ.msu.ru/ )

• International Media Management Academic Association's (IMMAA) Annual
• The future of media and communication policy research :: Department of
• About MSU :: Department of Journalism, M. V. Lomonosov Moscow State University

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>26) - hit-conf.imec.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>73) - chaos.phys.msu.ru/ )

• Links

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>26) - foroff.phys.msu.ru/ )

• Useful Information
• Faculty's Tuition Structure

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>168) - www.pereplet.ru/ )

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>51) - eng.geogr.msu.ru/ )

• Faculty of geography Lomonosov Moscow State University
• Department of Cartography and Geoinformatics
• Department of Cryolithology and Glaciology

with Materials Atoms Nuclear Instruments and Methods in Physics Research B xxx (2005) xxxґxxx www.elsevier.com/locate/nimb Cluster size dependence of sputtering yield by cluster ion beam irradiation T. Seki a a,b,* , T. Murase a, J. Matsuo a Quantum Science and Engineering Center, Kyoto University, Gokasyo, Uji ... These results suggested an empirical formula to calculate sputtering yield from the ion energy and the size distribution of the cluster. ... Fig. ...

Еще в разделе: (Показать все результаты (>107) - danp.sinp.msu.ru/ )

• Библиотеки