Monitoring of chloride and chloride-selective ion channels activity using genetically encoded fluorescent sensors. ... Quinoline-based fluorescent dyes sensitive to Cl have low biological toxicity, relatively good sensitivity and selectivity to Cl and rapid response to changes in Cl. ... Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ...

Еще в разделе: (Показать все результаты (>60) - www.msm.biophys.msu.ru/ )

• MSM 2007

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Tatjana Khruzina

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>31) - foroff.phys.msu.ru/ )

• A GLIMPSE BACK INTO THE HISTORY
• Admission Regulation
• The Faculty System of Education

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>16) - www.dubinushka.ru/ )

Dear Sergey Shakin: Per mit me to comment on the accusations br ought against Academician Nekipelov, which I read on the site of Polit.ru. In the first place, it is clear that the editors, having r equested an "academic" r eview of the Nekipelov book, have stretched and abused the comments by Professor Sonin. ... The other matters -- for instance whether ther e is too much citation for a monograph -- are entir ely subjective, matters basically of academic taste. ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf
• http://www.mse-msu.ru/Nekipeliv_31012011.pdf

... 13-Aug-2014 12:13 106K lk_20140815_0905.tar.. 15-Aug-2014 09:06 106K lk_20140901_0823.tar.. 01-Sep-2014 08:23 103K lk_20141016_1324.tar.. 16-Oct-2014 13:25 103K lk_20141211_1708.tar.. 11-Dec-2014 17:08 103K lk_20150430_0315.tar.. 30-Apr-2015 03:15 103K lk_20150430_0420.tar.. 30-Apr-2015 04:20 103K lk_20150818_1511.tar.. 18-Aug-2015 15:11 104K lk_20151113_1903.tar.. 13-Nov-2015 19:04 105K lk_20160314_0610.tar.. 14-Mar-2016 06:11 105K . ...

Еще в разделе: (Показать все результаты (>4) - scan.sai.msu.ru/ )

• The NMW survey homepage

e-mail: ibabich@mail.ru ) , , , , education, science, culture, dialogue, ethics , , , , . Dialogue on moral problems which excites modern society is developed by the state, church, public structures and scientific community. Cooperation in the field of spiritual and moral education of the Russian citizens contributes education to universal values promote the solution of actual social problems. ...

Еще в разделе: (Показать все результаты (>37) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/1/10.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/1/09.pdf

... about A. M. Baldin . ... Academician A.M.Baldin , an outstanding scientist in the field of elementary particle physics and atomic nucleus, was born on February 26, 1926 in the Krasnaja Presnja district of Moscow. ... In the early 70s, A..M.Baldin has determined long-term research goals in relativistic nuclear physics - a scientific trend of paramount importance for the national science - which arose at the meeting point of atomic nuclear physics and elementary particle physics. ...

Еще в разделе: (Показать все результаты (>172) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблем  и для их преподавания. ...

Еще в разделе: (Показать все результаты (>4) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>10) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

1995 marks the centenary of the birth of Academician Aleksandr Naumovich Frumkin, one of the founders of present day, XX century electrochemistry. ... A.N. Frumkin became a classic in his lifetime, and his foreign colleagues called him "the father of modern electrochemistry". ... Aleksandr Frumkin used to say that modern electrochemistry rests on three "whales": the theory of interfaces, diffusion kinetics, and the theory of the charge transfer across interfaces. ... Mag., 1920, vol. 40, no. 237, pp. ...

Еще в разделе: (Показать все результаты (>77) - electr003.chem.msu.ru/ )

• Boris B. Damaskin
• Vladimir Sergeevich Bagotsky
• Laboratory of Electrochemical energetics

New anaerobic process of nitrogen removal S. Kalyuzhnyi*, M. Gladchenko*, A. Mulder** and B. Versprille*** *Department of Chemical Enzymology, Chemistry Faculty, Moscow State ... Delft, The Netherlands (E-mail: b.versprille@biothane.nl) Abstract This paper reports on successful laboratory testing of a new nitrogen removal process called DEAMOX (DEnitrifying AMmonium OXidation) for the treatment of strong nitrogenous wastewater such as baker's yeast ...

Еще в разделе: (Показать все результаты (>108) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ekbio/article/JEE00-12.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/UASB2006.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/dpfl_model.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... Waterbirds around the world Breeding performance of tundra waders in response to rodent abundance and weather from Taimyr to Chukotka, Siberia Mikhail Y. Soloviev1, Clive D.T. Minton2 Pavel S. Tomkovich3 1Department of Vertebrate ... Nesting success measured within the breeding range depended on July temperatures only in the Ruddy Turnstone, and did not depend significantly on rodent abundance in any of the species under investigation. ... 2 3 Evaluation based on abundance of wader broods....

Еще в разделе: (Показать все результаты (>51) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Curlew_Sandpipers_Calidris_ferruginea_on_their_breeding_grounds.pdf
• http://vertebrata.bio.msu.ru/Poster_Gatilov.pdf
• http://vertebrata.bio.msu.ru/Shedlock_Okada_2000_BE.pdf

... info@ecfs.msu.ru . ... Topic 2: Barriers to Sustainable Soil.. ... We are inviting you to participate in our consultation on "Barriers to Sustainable Soil Management in Eurasia and possible ways for overcoming them".  ... Is workforce capacity in the Eurasian region sufficient for adopting sustainable soil management practices? ... Мы приглашаем вас принять участие в нашей консультации "Барьеры на пути к устойчивому землепользованию в Евразии и возможные пути их преодоления".  ... Topic 2 . ...

Еще в разделе: (Показать все результаты (>34) - ecfs.msu.ru/ )

• Agricultural markets and global state of food suply | ECFS
• Resources | ECFS
• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>3) - depni.sinp.msu.ru/ )

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...

160. http://seac47-2.phys.msu.ru/proc/E06_Gusiakov.pdf