... Решение системы n нелинейных уравнений с n неизвестными методом Брауна. zf30r_c находит решение системы N нелинейных уравнений F ( X ) = 0 с N неизвестными. ... K.M.Brown, A Quadratically Convergent Newton - like Method Based upon Gaussian Elimination, SIAM on Numerical Analysis, 6 (4), 1969. int zf30r_c (R_fp f, integer *n, real *eps, integer *ndig, integer *itmax, real *root, real *rab, integer *ierr) . ... заданное число уравнений системы (тип: целый); . ... для всех компонент системы или | ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
... 50, No. 10, 2005, pp. ... PHYSICS Stabilization of Turbulent Dynamics in Excitable Media by an External Point Action A. Yu. Loskutov, R. V. Cheremin, and S. A. Vysotskioe Presented by Academician A.R. Khokhlov May 13, 2005 Received May 16, 2005 In this paper, the behavior of an excitable medium in the state of developed spatio-temporal chaos is analyzed. We show that a weak point action on the medium results in the suppression of all spiral waves and stabilization of the system dynamics. ...
[
Текст
]
Ссылки http://chaos.phys.msu.ru/loskutov/PDF/Stabilization_by_point_exitations.pdf -- 225.8 Кб -- 05.02.2009 Похожие документы
... Курсы . ... О кафедре . ... List of Teacher Resources . ... Кафедра предоставляет студентам возможность обучаться по всем трем специализациям ИСАА: истории, филологии и экономике стран Востока. В пределах иудаики эти три специализации означаютљисторию евреев, еврейские языки и литературы и экономику государства Израиль. ... Кафедра организует приезд в Москву преподавателей из Еврейского университета в Иерусалиме (ведущего израильского университета) и стажировку студентов в Иерусалиме. ...
GSK-3 Inhibitors: The Dataset . ... We suppose that it will be useful for the other researchers in the field of chemoinformatics; the main peculiarity of this Dataset is wide activity range of compounds and significant diversity of the actives (true inhibitors). ... IC50 is given in nM (sic!) according to the data reported in the article. It's a text field (as well as the other raw activity data fields) and values like '>10000' are given for inactive compounds. ...
... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...
... ICONO Symposium on Femtosecond Laser Pulse Filamentation . Co-Chairs: Sea Leang Chin (Laval Univ., ... Russia) . ... In the past 15 years, he turned his attention to study the physics and applications of femtosecond laser filamentation in all optical materials, in particular, in air and is one of the leading scientists in this field. ... INVITED : в?? ... Efficient THz generation by optical rectification of femtosecond laser pulses and application of THz radiation for plasma investigation в??, ...
Educational Technology & Society 10(3) 2007 ISSN 1436-4522 : .. . ... 1995). . ... Education Technology & Society 9(1) 2006 pp. 422-427. [ .., 1993] . ... Education Technology & Society 5(1) 2002, pp 222-243. ... Brusilovsky P., 1995] Brusilovsky P. Intelligent learning environments for programming: The case for integration and adaptation // In: J. Greer (ed.) Proceedings of AI-ED'95, 7th World Conference on Artificial Intelligence in Education, Washington, DC, 16-19 August 1995, AACE, pp. ...
... 96-05-65519, отчет за 1997 год) . ... Dynamics of srtike-slip magmatic duplexes . ... During 1997, we conducted (1) field works in the South Ural area (for account of another financial sources), (2) theoretical investigations of the earlier studied strike-slip magmatic duplexes from Central Kazakhstan and the Kola-Karelian region, (3) analitical study of magmatic rocks composition (for account of another financial sources), and (4) development of computer databases and software. ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Dmitri Komissarov is a MSU-78 outfielder, who also takes coaching job on our team. During spring-summer-autumn work outs he helping our Head coach with drills and stretching. He takes a 3rd Base coach job on the games. He is an excellent athlete with good speed and range in the field. ... In 1997 he played for SKA-MVS, but in 1998 he has return to the MSU-78. Here Dmitri' statistics for 1997 and 1998 seasons . ... TEAM . ... 1997 . ... 1998 . MSU 78ers .316 . ...
... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...
... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...
... Electronic journal Issue 4. 10 september 2004 Ulrich M. Sustainable Management of Natural Resources Introduction. ... To learn about the dynamics of natural resource management and the tragedy of the commons by means of a direct experience in the simulation game «NEW COMMONS GAME». ... 2) Tragedy of the commons and management of natural resources. ... The simulation game was followed by a short debriefing on the dynamics of the tragedy of the commons and natural resource management. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf -- 224.7 Кб -- 06.07.2014 Похожие документы
Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...