hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...

Еще в разделе: (Показать все результаты (>2) - hpc.cmc.msu.ru/ )

The head of the team - Vladimir A.Veselovsky , Professor of Biophysics . ... M.V.Lomonosov State University, Moscow, Russia . ... Induced by different factors (light, H 2 O 2 , KMnO 4 , electric current etc.) luminescence of roots and leaves was used for investigation of mechanisms of damage in cells and for plant resistance determination. ... Moscow. Znanie (in Russian). 1964. 48 p. Tarusov B.N., Veselovsky V.A. Ultra Weak Light Emission of Plant and its Practical Significance. ...

Еще в разделе: (Показать все результаты (>15) - www.biophys.msu.ru/ )

... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...

Еще в разделе: (Показать все результаты (>3) - www.mgumus.chem.msu.ru/ )

• MGUMUS -- Ekaterina A. Ilyukhina

Вы посетили: autobio_engl.html . ... 1998: Student at the Moscow State University, Department of Mathematics and Mechanics . ... Degree, Moscow State University . ... 2001: Ph.D. student at the Moscow State University, Department of Mathematics and Mechanics, Faculty of Algebra . ... 2007: Assistant professor at the Moscow State University, Department of Mathematics and Mechanics, Faculty of Algebra . ... staff/guterman/autobio_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>19) - halgebra.math.msu.su/ )

• staff:guterman:englver.html | Кафедра высшей алгебры

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

PhD Summer School on Scentific Computing . ... Paula Carroll, University College, Dublin, Ireland . ... Irina Fedulova and Sergey Pevtsov, Moscow State University, Russia . ... John Houlihan, Waterford Institute of Technology, Ireland . ... Jimmy McGibney, Waterford Institute of Technology, Ireland . ... Micheal O hEigeartaigh, Waterford Institute of Technology, Ireland . ... Paul O'Kelly, Waterford Institute of Technology, Ireland . ... Michael Ryan, Waterford Institute of Technology, Ireland . ...

Еще в разделе: (Показать все результаты (>19) - angel.cs.msu.su/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>151) - www.kosmofizika.ru/ )

• SAMNET Magnetometers
• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE
• Азм есм

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>34) - mailybaev.imec.msu.ru/ )

• Dr Alexei A. Mailybaev
• Book review by Professor Alois Steindl

МОСКОВСКИЙ . ГОСУДАРСТВЕННЫЙ . УНИВЕРСИТЕТ . имени . М.В.ЛОМОНОСОВА . ... ФАКУЛЬТЕТ . ... МАТЕМАТИЧЕСКОЙ ФИЗИКИ . ... Московский государственный университет . имени М.В.Ломоносова (факультет ВМК) . ... университет имени М.В.Ломоносова факультет ВМК . ... федеральное государственное бюджетное образовательное учреждение высшего образования 'Московский государственный университет имени М.В.Ломоносова' ОГРН: 1037700258694 . ... МГУ имени М.В.Ломоносова (Факультет ВМК ) . ...

Еще в разделе: (Показать все результаты (>56) - mph.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...

Еще в разделе: (Показать все результаты (>4) - matematika.phys.msu.ru/ )

... Aleksandra A. Panyutina . ... Born in Moscow on March, 17, 1984 . Education: Moscow State University (MSU), Biological faculty, 2002-2007. ... Key words: mammalian flight, arboreal locomotion, functional anatomy, bats, gliders, locomotion biomechanics . Research interests: functional anatomy, transformation of locomotor apparatus of tetrapods in the process of adaptation to new habitats, origin and evolution of aerial locomotion in mammals. ORCID: http://orcid.org/0000-0002-8379-8526 . ...

Еще в разделе: (Показать все результаты (>1851) - zmmu.msu.ru/ )

• XIV International Ornithological Conference of North Eurasia: Organizers

ANTARES Collaboration Meeting . ... Group photo in front of Lomonosov monument and MSU Main Building . ... We are pleased to welcome you to Moscow State University, where June 6-10, 2011 the ANTARES Collaboration Meeting will be held. Moscow State University is one of the tourist attractions of Moscow, an architectural monument and the tallest university building of the world. ... Antonio Capone, Physics Department University "Sapienza" and INFN, Roma . ... Salvatore Mangano, IFIC-CSIC, Valencia . ...

Еще в разделе: (Показать все результаты (>29) - antares.sinp.msu.ru/ )

... 2 Structure of Curriculum Syllabus Design and Selecting Readings : Kathleen Deloughery, Rockefeller College, State University of New York Main trends in the US higher education over the past decades Faculty-administrator interactions at US universities : . University of Michigan, Department of Economics 3 Choosing Assignments Principles of Grading Encouraging Student Interaction : Kathleen Deloughery, Rockefeller College, State University of New York : .. ...

Еще в разделе: (Показать все результаты (>105) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/page_156.html
• Visa Support Information
• Conference program

... After the edit, recompile the kernel and recompile the Apache server then reboot. ... Addendum for very heavily loaded BSD servers . ... If you're running a really busy BSD Apache server, the following are useful things to do if the system is acting sluggish: . ... Here are some BSD kernel config parameters (actually BSDI, but pertinent to FreeBSD and other 4.4-lite derivatives) from a system getting heavy usage. ... Rebuilding the FreeBSD kernel on an AMD-133 (486-class CPU) web-server with . ...

Еще в разделе: (Показать все результаты (>175) - oit.cmc.msu.ru/ )

• Hints on Running a High-Performance Web Server

... Business Education . ... His business degree is from California State University, Hayward - but he got it through a Moscow program that celebrated its 10-year anniversary last month. ... Particularly since 1999, a wealth of MBA programs have sprung up with lots of choices - studying in English vs. in Russian, in the evenings vs during the day, private schools vs state-run universities, Russian degrees vs. ... The Graduate School of International Business offers several well-respected MBA programs. ...

Еще в разделе: (Показать все результаты (>1567) - www.mgubs.ru/ )

• В газете The Northeastern Voice (Northeastern University) вышла статья про
• Doing Business in Russia | Высшая школа бизнеса МГУ им. Ломоносова
• Moscow Times о российских программах Executive MBA

... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...

Еще в разделе: (Показать все результаты (>40) - num-anal.srcc.msu.ru/ )

... Полная версия этой страницы: Постдок: теоретическая физика высоких энергий. Студенческий форум Физфака МГУ > Общий > Работа . ... Theoretical Particle Physics . ... The high energy theory group at Wayne State University (http://www.physics.wayne.edu/~apetrov/particle_nuclear/) anticipates making one postdoctoral research appointment to start September 1, 2007 or earlier. ... Department of Physics and Astronomy . ...

Еще в разделе: (Показать все результаты (>1191) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Темы к экзамену по английскому
• Студенческий форум Физфака МГУ > The Significance of Non-ergodic Property of