... The study of adaptive variability, i.e. the study on the population level of the physiological adaptation of the human organism to a variety of environmental conditions, is the main purpose and the basic principle of physiological anthropology. ... Regional rates of hormonal activity of indigenous population of different ethno-territorial groups that we have elaborated broaden our notions about common conformities of age variability and aging and the reasons of these processes. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2013_3.doc -- 59.0 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2013_3.doc -- 59.0 Кб -- 23.07.2015 Похожие документы
... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...
Next] [Previous] [up] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . Permission is granted to make and distribute verbatim copies of this manual provided that the copyright notice and these paragraphs are preserved on all copies. ... The Unidata Program Center is managed by the University Corporation for Atmospheric Research and sponsored by the National Science Foundation. ... NetCDF User's Guide for C - 6 Nov 1997 . ...
Research topics . ... This group is formed to study the reactions at semiconductor surfaces. ... Group members: . ... M.V. Lomonosov Moscow State University: . ... Dr. Tatiana S. Zyubina, senior scientific researcher (quantum chemical modeling) . ... Joint Semiconductors Surface Study group: research sketches . The Joint Semiconductors Surface Study (JSSS) group was developed on the base of Inorganic Chemistry division, Chemistry dept. of M.V. Lomonosov Moscow State University. ...
... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
On the 3th of November a report of Drozdov Alexander, manager of Intel Corp. in Russia was presented on the seminar "Mathematics of computers, chips, and electronic circuits". ... Cadence Design Systems, Inc. and Intel, Corp. supports this seminar. ... The main purposes of this seminar are the following: . ... The seminar implements scientific and technical contacts for both domestic and foreign experts in the field of design and use of electronic computing systems. ... Seminar organization: . ...
... Вы находитесь на сайте кафедры теоретической физики физического факультета МГУ им. М.В. Ломоносова. Здесь Вы можете получить разнообразную информацию о сотрудниках, читаемых курсах лекций, познакомиться с историей кафедры. О кафедре . ... Кафедра теоретической физики физического факультета МГУ им. М.В. Ломоносова, 2006 ...
In Silico Biology 3 (2003) 197204 IOS Press 197 The Channel in Transporters is Formed by Residues That Are Rare in Transmembrane Helices Olga V. Kalinina1,*, Vsevolod J. Makeev1, Roman A. Sutormin1, Mikhail S. Gelfand1,2 and Aleksandra B. Rakhmaninova2 1 2 State Scientific Many genes encoding known or putative transport proteins are found in bacterial genomes. ... It is based on the analysis of amino acids frequencies in bacterial secondary transporters. ... Proteins 51, 8595. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/insilicobiol_2003.pdf -- 411.4 Кб -- 21.12.2005 Похожие документы
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... Новости . ... Математический семинар Глобус. 11 марта 2004 г. версия для печати . 11 марта 2004 года (четверг) в 15:40 в конференц-зале НМУ, Б. Власьевский, 11 состоится очередная лекция семинара Глобус "Random walks along orbits of chaotic maps". ... Consider a random walk. A point x\in T^d jumps to the image fx with probability p(x) and into the preimage f^{-1}x with probability 1-p(x). ... MMOnline . ... 21 июня Магистратура мехмата МГУ проведет День открытых дверей . ... Новости МГУ . ...
Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...
... Advance Conference Program . Advance Conference Program is available for download below: . б б б б б б б б б б б б б б б б б б ICONO-LAT-2013-program.pdf . Conference Technical Digest . The Conference Technical Digest, which is distributed among the conference participants on CD ROM, is available for download from the link below: . б б б б б б б б б б б б б б б б б б icono-lat-2013-technical-digest.zip . ... Advance program . ... Registration info . ... Contacts . ... Exhibit . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...
... THEORETICAL BASES AND EXPERIMENTAL ANALYSIS OF SOIL SOLUTION TRANSFORMATION UNDER INDUSTRIAL POLLUTION AND REHABILITATION OF SOILS . ... Transformation of soils solutions under air pollution impact. ... Prediction of soil solution changes in response to soil contamination and rehabilitation with dynamic bigeochemical models. The project aims to study, both theoretically and experimentally, response of soil solutions to contamination/remediation of soils by/from heavy metals. ...