MSU . Science Park . ... The program will give the participants the opportunity to establish business contacts that will help the development of their own projects in the world market in future. ... The educational trip is organized by Moscow Department of Science, Industrial Policy and Entrepreneurship. ... Timetable for the program: 05 to 14 December 2012. ... Bld.75, 77, Leninskie Gory, 119992, Moscow, Russia . JSC MSU Science Park. Phone: (495) 930 8454, 930 8455 . ...

Еще в разделе: (Показать все результаты (>2) - www.sciencepark.ru/ )

... The collection includes the results of Russian and foreign scientific researches on the contemporary condition of human resources management. ... Key words: human resources management, labor activity motivation, organizational leadership, people development in organization, efficiency of the labor activity, public administration staff, corporate training, social-and-psychological organizational climate, staff recruitment, employee appraisal. ФГУ МГУ 2016 . ...

Еще в разделе: (Показать все результаты (>6) - www.spa.msu.ru/ )

Воздействие автомобилизации на загрязнение окружающей среды городов / Шадрин Н. В. // Трансп. средства Сибири, 2003. ... Центральные части городов отличаются высокой плотностью улично-дорожной сети с насыщенными транспортными и пешеходными потоками, требующими регулирования их движения. ... Как правило, с увеличением размера города доля мобильных источников загрязнения (в основном автотранспорта) в общем загрязнении атмосферы возрастает, достигая 75-80%. ...

Еще в разделе: (Показать все результаты (>3) - ecoinformatica.srcc.msu.ru/ )

... Геология >> Геохимические науки >> Минералогия | ... Химический состав аурикуприда (390-393) и купроаурида (394-400), слагающих небольшие зерна в прожилках кальцита в лиственитизированных родингитах Восточного рудного тела Золотой Горы . ... Генетическая минералогия медистого золота гидротермальных месторождений на примере Золотой Горы (Урал): Монографии . ... Генетическая минералогия медистого золота гидротермальных месторождений на примере Золотой Горы (Урал): ВВЕДЕНИЕ . ...

Еще в разделе: (Показать все результаты (>8) - phys.web.ru/ )

... Rasing2 1 2 1 Department of Physics, Moscow State University, Moscow 119899, Russia Research Institute for Materials, University of Nijmegen, Toernooiveld 1, NL 6525 ED Nijmegen, The Netherlands (Received 27 March 1996) Optical second harmonic generation from Si(111)-SiO 2 interface shows a strong nonmonotonic dependence on the oxide thickness between 2 and 300 nm. ... Electronic address: aktsip@astra.phys.msu.su [1] H. B. G. Casimir and D. Polder, Phys. Rev. 73, 360 (1948). ... Phys. Usp. ...

Еще в разделе: (Показать все результаты (>7) - shg.phys.msu.ru/ )

... ЛЕКЦИИ . МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... С середины сентября по апрель в аудитории 16-10 главного здания МГУ по субботам с 16 часов 45 минут до 18 часов 40 минут лучшие московские преподаватели и ученые читают научно-популярные лекции по математике. ... автор книг '1001 задача по математике', 'Математический кружок', 'Математический праздник', 'Турниры математических боев имени А.П. Савина', 'Арифметика' и 'Арифметика-2', преподаватель Малого мехмата и ДНТТМ, с 1992 по 2013 год - учитель гимназии 1543. ...

Еще в разделе: (Показать все результаты (>3) - mmmf.msu.ru/ )

102:67­76 DOI 10.1007/s11120-009-9491-6 REGU LA R P APER Probing of photosynthetic reactions in four phytoplanktonic algae with a PEA fluorometer T. K. Antal ф D. N. Matorin ф L. V. Ilyash ф A. A. Volgusheva ф V. Osipov ф I. V. Konyuhov ф T. E. Krendeleva ф A. B ... Accepted: 17 August 2009 / Published online: 3 September 2009 с Springer Science+Business Media B.V. 2009 Abstract High-resolution light -induced kinetics of chlorophyll fluorescence ( OJIP ...

Еще в разделе: (Показать все результаты (>12) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3336.pdf

... Equivalent models. 3 prl = l ,clay K pclay C clay 1 + l ,s (K ps - C clay ) , (3) and at Kps < C clay prl = l ,clay 1 K pclayC (4) clay where prl - resistivity of rock consisted of a sand - clay mix at parallel connection of capillaries; l,clay ­conductivity of a liquid in clay capillaries; l,s - conductivity of a liquid in sand capillaries; Kpclay - clay porosity; Kps - sand porosity; clay - volumetric clay content in a sandy-clayish mix. ... The code of curves - volumetric clay content and...

Еще в разделе: (Показать все результаты (>11) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/167.pdf
• http://geophys.geol.msu.ru/shevnin/publ/122.pdf
• http://geophys.geol.msu.ru/shevnin/publ/135.pdf

... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral­ time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...

Еще в разделе: (Показать все результаты (>13) - acoustics.phys.msu.ru/ )

Cell. ... 2012) 69:1787­1797 DOI 10.1007/s00018-011-0895-z Cellular and Molecular Life Sciences REVIEW Cytochrome c: the Achilles' heel in apoptosis A. V. Kulikov · E. S. Shilov · I. A. Mufazalov · V. Gogvadze · S. A. Nedospasov · B. Zhivotovsky Received: 5 September 2011 / Revised: 30 October 2011 / Accepted: 22 November 2011 / Published online: 17 December 2011 с Springer Basel AG 2012 Abstract Cytochrome c is a well-known ... How is cytochrome c released from mitochondria? ...

Еще в разделе: (Показать все результаты (>19) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/about/struct/labs/lima/paper1.pdf

PHYSICS OF FLUIDS 19, 061702 2007 The wimple : A rippled deformation of a wetting film during its drainage Vladimir S. Ajaev Department of Mathematics, Southern Methodist University, Dallas, Texas 75275 Roumen Tsekov ... Russia Received 27 February 2007; accepted 24 April 2007; published online 19 June 2007 It has long been accepted that hydrodynamic pressure in a draining fluid film can cause inversion of curvature of a fluid-fluid interface, creating the so-called ... 5 FIG. ...

Еще в разделе: (Показать все результаты (>9) - nanofluidics.phys.msu.ru/ )

... for Food Security . Home Events Online Consultation on Network and Partnerships.. ... This discussion will serve as a preparatory stage for the upcoming International Conference on International Conference on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership to be held in Bishkek, February 29-March 2, 2016. ... Topic 1: Building the Eurasian Food Security Network . ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ...

Еще в разделе: (Показать все результаты (>4) - ecfs.msu.ru/ )

... Берлин - Петербург - Москва, издательство 3.И. Гржебина, 1923. 507с. Перейти к текстовому блоку: выберите текстовый блок со стр . --- стр . 20 со стр . 21 --- стр . 36 со стр . 37 --- стр . 53 со стр . 54 --- стр . 69 со стр . 70 --- стр . 87 со стр . 88 --- стр . 103 со ... ОГЛАВЛЕНИЕ Стр. ...

Еще в разделе: (Показать все результаты (>4) - kvartira-belogo.guru.ru/ )

Шулейкин В.В. Физика моря. ... Изд-во МГУ, 1969, 206 с. Пивоваров А.А. Термика замерзающих водоемов. ... М., Изд-во МГУ, 1978, 390 с. Михайлова Н.А. Перенос твердых частиц турбулентным потоком воды. Л., "Гидроме-теоиздат", 1966, 234 с. Кононкова Г.Е., Показеев К.В. Динамика морских волн. ... М., Изд-во МГУ, 1987,92 с., Ч.2. ... Изд-во ВГУ,2000, 176 с. Трухин В.И., Показеев К.В., Куницын В.Е., Шрейдер А.А. Основы экологической гео-физики. ... М. МГУ. ... 2002-2016, Кафедра физики моря и вод суши . ...

Еще в разделе: (Показать все результаты (>8) - ocean.phys.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Orbital Data and Parent Star Data for: HD117618_ b . ... Orbital eccentricity . ... Stellar mass . ... Stellar T_eff . Kelvin . ... Planetary T_eff . ... Stellar Radius . ... Predicted Planetary Radius (w/o core) . ... T_circ (w/o core) . Gyr . ... T_damp (w/o core) . ... Bodenheimer, Laughlin, and Lin 2003, Astrophysical Journal, v. 592, 555-563. ... Adams and Laughlin 2006, ApJ : link . ...

Еще в разделе: (Показать все результаты (>13) - observ.pereplet.ru/ )

• Data for HD41004A_ b
• Data for HD73526__ b
• MASTER

Список литературы для подготовки к кандидатскому экзамену по специальности 23.00.06 - «Конфликтология» (Кафедра российской политики) 1. Манойло А.В. Гл. ... Политические конфликты. ... Ун-та, 2013. 472 с. 2. Манойло А.В. Технологии несилового разрешения современных конфликтов. А.В. Манойло; под ред. проф. А.И. Петренко. ... Глухова А.В. Политические конфликты: основания, типология, динамика. ... Соловьев А.И., Политология: Политическая теория, политические технологии. ... М., 1996. ...

Еще в разделе: (Показать все результаты (>3) - polit.msu.ru/ )