PhD Summer School on Scentific Computing . ... Paula Carroll, University College, Dublin, Ireland . ... Irina Fedulova and Sergey Pevtsov, Moscow State University, Russia . ... John Houlihan, Waterford Institute of Technology, Ireland . ... Jimmy McGibney, Waterford Institute of Technology, Ireland . ... Micheal O hEigeartaigh, Waterford Institute of Technology, Ireland . ... Paul O'Kelly, Waterford Institute of Technology, Ireland . ... Michael Ryan, Waterford Institute of Technology, Ireland . ...

Еще в разделе: (Показать все результаты (>69) - angel.cs.msu.su/ )

... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...

Еще в разделе: (Показать все результаты (>5) - ged.chem.msu.ru/ )

... Virtual work . ... A piecewise polynomial defined on this partition is a polynomial of low degree on each element . ... Partitioning a matrix in rows and columns . ... Matrix partitioning . Matrix partition . ... Partition of the matrix into blocks . Partitioning the matrix into blocks . ... Column partition of a (the) matrix . Column partitioning of a (the) matrix . ... Row partition of a (the) matrix . Row partitioning of a (the) matrix . ... Разложение в . ... Arcsine distribution . ...

Еще в разделе: (Показать все результаты (>82) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/list_wrk/ps/b1_47.ps
• http://num-anal.srcc.msu.su/eng_math/redict/15.htm
• Параллельные программы. ЛИТЕРАТУРА

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>6) - npidb.belozersky.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

... All the galaxies are divided into 4 groups depending on the environment type; every subsample contains more than 10 galaxies. ... An effect of environments is seen both for the nuclei and for the bulges: if we consider the clusters (Virgo and Ursa Ma jor) and group centers as dense environments and the field and group periphery as sparse environments, then in the dense environments the stellar populations of S0s are in average older by 4­5 Gyr than in the sparse ones. ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/postbr1.pdf
• http://sn.sai.msu.ru/~sil/preprints/ar281.pdf
• http://sn.sai.msu.ru/~sil/preprints/990234.ps.gz

THE 75th NAME-LIST OF VARIABLE STARS. ... The 75th Name-List consists of two tables. ... the literature, taken from positional catalogues, including USNO A1.0/A2.0 and GSC, or determined by the authors); the range of variability (sometimes the column Min gives, in parentheses, the amplitude of light variation; the symbol ( means that the star , in minimum light, becomes fainter, than the magnitude indicated); and the system of magnitudes used ( P are photographic ...

Еще в разделе: (Показать все результаты (>25) - www.sai.msu.ru/ )

• MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE)
• Moscow Astronomical Plate Archives: Contents, Digitization, Current and

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

Физический факультет МГУ . Главная . О кафедре . ... Заседание кафедры 15.10.15 . ... CrystEngComm, (2014). ... Лауреат Нобелевской премии по физике 1978 года. ... Лауреат Нобелевской премии по физике 1962 года. ... Кафедра физики низких температур и сверхпроводимости (ул. Академика Хохлова стр.8, Физический факультет, Ленинские горы д.1, ГСП-2, Москва 119991 Россия. +7 (495) 939-4811 . ... Физический факультет МГУ имени М.В. Ломоносова ї 2014 . ...

174. http://new.math.msu.su/department/probab/bsk_18_6.html

175. Институт Проблем Информационной Безопасности

176. Invited speakers

177. The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

178. http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.doc

179. Geometric optimal control theory and its applications

180. For three and half years of activity the participants of Ecological Cooperation