... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...
LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Очередное заседание научно-исследовательского семинара факультета 8 апреля 2016 года . ... Заседание Московского математического общества 5 апреля 2016 г. 2 апреля 2016 - 10:18 . ... Юбилей проф. Шешенина С.В. 28 марта 2016 - 13:43 . ... Заседание Московского математического общества 29 марта 2016 г. 24 марта 2016 - 14:23 . День открытых дверей механико-математического факультета 27 марта 2016 г. 24 марта 2016 - 13:03 . ... 2016 Механико-математический факультет МГУ им. М.В. Ломоносова . ...
... Главная . ... О кафедре . ... Здесь Вы можете получить самую разнообразную информацию о кафедре, ее сотрудниках, курсах лекций, познакомиться с историей кафедры. ... Числовые и нечисловые поля. 24 сентября в 15.20 состоится заседание -- научный семинар кафедры математики. ... Студентов младших курсов: информация о кафедре, темы курсовых работ.. Сотрудников кафедры: описание курсов, материалы (задачи, контрольные вопросы) .. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
... 1997. ... Federation and regional policy . ... territorial unity' and 'self-definition of peoples' . in the Constitution of the Russian Federation .. ... Natio territorial organization of the state .. ... Local legislation: . ... The problems of scanty peoples of Russian North .. ... Bills and legislative proposals. ... On the question of legislative regulation . of the state antialchohol policy .. ... The Principal Decisions of the State Duma . in December 1996 - January 1997 .. ...
The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...
Evolution of the double neutron star merging rate and the cosmological origin of Gamma-ray burst sources " , Astroph.J., 1995, v.454, 593-596 (Lipunov, V.M. Postnov, K.A. and Prokhorov M.E.) . Evolution of SupernovaЃExplosion Rates in theЃ Universe (Jorgensen H., Lipunov.M., Panchenko I.E., Postnov K.A., Prokhorov M.E.) ApJ, 1997, v.486,p.110 . ... Formation of a Gravitationally Bound Object after Binary Neutron Star Merging and GRB phenomena " (G.V.Lipunova, V.M.Lipunov). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...
The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...
Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...
... Institute of Mechanics . ... In 1977- 1991 A .P.Seyranian was a Member of Scientific Staff at the Institute of Problems in Mechanics of the Academy of Sciences in Moscow . ... Since 1993 A .P.Seyranian is a Leading Researcher and Professor of the Institute of Mechanics , Moscow State Lomonosov University . ... In 2003 he became an Invited Speaker and Chairman of the Session 'Stability and Control Problems in Mechanics' at the conference 'Physics and Control 2003' , Sankt-Petersburg. ...
Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf -- 1942.1 Кб -- 18.10.2010 Похожие документы
Nuclear - radiation on the flight at LHC energies V.L.Korotkikh, L.I. Sarycheva Moscow State University, Scobeltsyn Institute of Nuclear Physics UPCs in Heavy Ion Collisions Wokshop, 8-9 March, 2002 ·Ultra-peripheral nuclear collisions and the signatures ·Excitation of discrete nuclear levels in AA collisions · - radiation as a possible trigger for UPCs · Nuclear beam monitoring at ... 33 , 6.59 MeV 4. ... 51 , 4.49 MeV E' 2AE0 21 GeV ' 1 Discrete levels of Ca Endt et al. ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...
[
Текст
]
Ссылки http://antares.sinp.msu.ru/docs/Anisotropy_2011Bamberg.pdf -- 1353.8 Кб -- 16.12.2013 Похожие документы
Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...
[
Текст
]
Ссылки http://www.suny.msu.ru/en/CyberCon05En.doc -- 46.0 Кб -- 03.10.2005
[
Текст
]
Ссылки http://suny.msu.ru/en/CyberCon05En.doc -- 46.0 Кб -- 03.10.2005 Похожие документы