... The main physical factor influencing sound propagation in the ocean is water motion altering the sound speed and, consequently, the travel time of the acoustic signal. ... This paper describes the method and results of an experimental investigation of acoustic signal travel time fluctuations on a super-long path Hawaii ­ Kamchatka. ... Using the M-sequence allows one to measure travel time fluctuations of acoustic signal propagating along different ray groups [Zverev and Stromkov, 2001]. ... Figure...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E08_Inoue.pdf
• LOCAL TSUNAMI WARNING AND MITIGATION

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>26) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Anisotropy_2011Bamberg.pdf
• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf
• http://antares.sinp.msu.ru/seminar/Yakovenko.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...

Еще в разделе: (Показать все результаты (>39) - www.inorg.chem.msu.ru/ )

• Inorganic Chemistry Division
• Group of Hydrothermal Synthesis :: News
• Group of Hydrothermal Synthesis :: Awards

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf

... 1997. ... Federation and regional policy . ... territorial unity' and 'self-definition of peoples' . in the Constitution of the Russian Federation .. ... Natio territorial organization of the state .. ... Local legislation: . ... The problems of scanty peoples of Russian North .. ... Bills and legislative proposals. ... On the question of legislative regulation . of the state antialchohol policy .. ... The Principal Decisions of the State Duma . in December 1996 - January 1997 .. ...

Еще в разделе: (Показать все результаты (>5) - www.niiss.ru/ )

... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... После окончания в 1985 году средней школы поступил на физический факультет МГУ. В 1994 году закончил аспирантуру кафедры математики физического факультета МГУ. С 1994 года сотрудник кафедры. ... A.V. Shchepetilov. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>18) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>2) - www.rlcentre.com/ )

О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...

Еще в разделе: (Показать все результаты (>66) - dfgm.math.msu.su/ )

• Titles of talks

BNL PREPRINT BNL­QGS­98­0501 Study of Ї pp Baryon Exchange Processes V. L. Korotkikh 1;2 June 25, 1998 abstract The cross­section of the process Ї p + p ! ... ъ + + ъ \Gamma We repeated Barger and Cline's [3] calculation of reaction (3) and received the same 2 results at 10 GeV with their parameters: fi \Delta 8ъ = 0:10 GeV \Gamma1 ; s 0 = 2:85 GeV 2 ; ff \Delta (u) = 0:15 + 0:9 u: (5) The differential cross­section depends on these parameters as dЇoe du = 389:3 Їb ъ 2 s / fi \Delta 8ъ ! ...

Еще в разделе: (Показать все результаты (>56) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/UPC_2002.pdf
• http://lav01.sinp.msu.ru/~vlk/UPC_2008_orig.pdf
• http://lav01.sinp.msu.ru/~vlk/report_E852.ps

The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...

Еще в разделе: (Показать все результаты (>80) - sai.msu.ru/ )

• Future Prospects of Variable-Star Catalogues
• Презентация PowerPoint

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>7) - www.fbm.msu.ru/ )

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>29) - phys.web.ru/ )

... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...

Еще в разделе: (Показать все результаты (>12) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

... There is a serious question in Congress' agenda - strategy of Higher School development, and certainly, vital problems of your institutions, especially actual in the current economic situation. ... A month ago, I have given several commissions, aimed to support Russian students, the system of higher professional education and job placement of graduates. ... I would like to mention that legal requirements to establish Federal and national research universities are formulated now. ...

Еще в разделе: (Показать все результаты (>36) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/396.doc
• http://www.rsr-online.ru/doc/norm/12.doc
• http://www.rsr-online.ru/doc/2011_10_31/4.pdf

... Spontaneous chemiluminescence of seedling roots is a result of lightning of cell' surface of roots [mainly growth and root hair zones]. ... There is a "burst" of spontaneous chemiluminescence (oxidative stress) when plant roots are situated in stress conditions (high and low temperatute, salt, osmotic, abiotic- and biotoxines). ... Veselovsky V.A., Sekamova E.N., Tarusov B.N. On mechanism of spontaneous luminescence of organisms. ... Veselovsky, V.A., Veselova, T.V. Spontaneous luminescence. ...

Еще в разделе: (Показать все результаты (>10) - biophys.msu.ru/ )

• CURRICULUM VITAE
• C U R R I C U L U M V I T A E
• Stress of plant cells

... Process of Forming a Company - Discussion Question . ... You receive appropriate support from the University. Also University of Alberta statistics show that very few (less than 5%) technologies are successfully commercialized independently, whereas 50% of the technologies accepted by the University of Alberta are successfully commercialized. ...

Еще в разделе: (Показать все результаты (>33) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Приз в 1 миллион долларов за решение каждой из семи математических проблем . ... Научная лаборатория школьников . ... CMI - The Clay Mathematics Institute (Кембридж, Штат Массачусетс) - назвал семь нерешенных математических проблем - "Millennium Prize Problems", за решение каждой из которых будет выплачен $1 млн. К . 16.01.2003 Проблема Кука . ... Научная Сеть . ...

Еще в разделе: (Показать все результаты (>213) - www.nature.web.ru/ )

• Theoretical Computer Science: взгляд математика
• На следующей неделе в Протвино состоится 24-я Международное совещание по физике
• Приз в 1 миллион долларов за решение каждой из семи математических проблем