Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>24) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf
• http://www.mse-msu.ru/CV_Edoardo_Reviglio.pdf
• http://www.mse-msu.ru/IV_GMM_Program%20Peracchi.pdf

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>6) - www.rlcentre.com/ )

A Short Course in Differential Geometry and Topology A.T. Fomenko and A.S. Mishchenko sP A Short Course in Differential Geometry and Topology A.T . ... Partition of Unity 2.4.1 Functional separability 2.4.2 Partition of unity 3 CONTENTS 51 52 54 Smoot h Manifolds (General Theory ) 57 3.1 Concept of a Manifold 59 3.1.1 Main definitions 59 3.1.2 Functions of change of coordinates. ... Frenet formulae 4.1.2 Theory of spatial curves. ... Examples and illustrations are included throughout the chapter. ...

Еще в разделе: (Показать все результаты (>144) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2010/view%5B1%5D.pdf
• S.P.Novikov Seminar

... Research . Research Areas . ... Home Research Research Areas . Principal areas of scientific research: . experimental study of thermodynamic properties of compounds by means of e.m.f.- and calorimetry methods; . ... developing mathematic methods and software packages for thermodynamic simulations; . ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>23) - td.chem.msu.ru/ )

• PhDi Laboratory of Chemical Thermodynamics
• Carbamide Laboratory of Chemical Thermodynamics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

Lomonosov Moscow State University . ... Academic Programs . ... Academic Departments Programs . ... Russian Language Program . ... There is a well-known fact that if one doesn't know any foreign languages, he has no notion about his mother tongue. ... Moreover, the academic content is connected with the creation of texts in the Russian language relevant to a plan of a speaker and a writer. ... Address: MSU, Faculty of Foreign Languages and Area Studies, Russia, 119192, Moscow, 31/1, rooms 234-235 . ...

Еще в разделе: (Показать все результаты (>138) - ffl.msu.ru/ )

• Научная жизнь

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>13) - heritage.sai.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

• Symposia
• Excursions

... Local similarities and pairwise sequence alignment . ... Multiple sequence alignment . ... This includes representation in corresponding databases of information about structurally and functionally important fragments and patterns, taking into account obtained statistical information about sequences and three-dimensional structure data. ... The alignment procedure for each shift of the sequences finds in the local similarity map a series of non-overlapping diagonal segments and computes its power. ...

Еще в разделе: (Показать все результаты (>210) - www.genebee.msu.ru/ )

• BLAST Frequently Asked Questions (FAQ)
• Основной заголовок
• Impact Factors of Scientific Journals in 1999

... Магистерское образование . ... Магистерские программы . ... Магистерские программы (учебные планы) . ... Introduction to Cryptography . ... Basic requirements for data security in software systems. ... Lecturer: associate professor Primenko E. A. Mathematical Theory of Information . ... Addition operation of elliptic curve's points. f Postnikov's theorem.Theorems on the order of elliptic curve for certain types of primes. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>16) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Магистерское и послевузовское
• Master program "Enterprise Information Systems" | Магистерское и послевузовское

... Shipping Icons . E-Commerce Icons . Building Icons . Hosting Icons . ... But to make your website or interface design a real eye-catcher there was one thing missing: Icons! Icons are an essential tool to simplify user interfaces and today almost every major website uses icons to highlight important parts in their content. ... Visit Website . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>8) - physcontrol.phys.msu.ru/ )

• List All Categories
• Widgetkit

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>14) - suny.msu.ru/ )

• Центр по делам России и США :: Новости

... Faculty of Physics . M.V.Lomonosov Moscow State University . 7 (495) 939-16-82 info@physics.msu.ru . ... Contacts . ... Education . ... Dr. Michael Tribelsky (Faculty of Physics, Lomonosov Moscow State Univ.) in cooperation with his colleagues from the Institut Fresnel (France) and the Univ. of Cantabria (Spain) discovered a possibility of using dielectric spheres with a high refractive index as multifunctional elements of optical devices. ... 7 495 939-16-82, . ... Faculty of Physics, 2016 . ...

Еще в разделе: (Показать все результаты (>199) - phys.msu.ru/ )

• Сотрудники физического факультета МГУ

... H. Purcell: The Fairy Queen - Act II . Г. Перселл: Королева фей - Акт II . Act I . ... The fairies entertain their queen with songs dances until Titania asks them to sing her a lullaby: immediately four allegorical figures - Night, Mystery, Secresie and Sleep - approach to do her bidding. ... Феи развлекают свою королеву песнями и танцами, пока она не просит спеть ей колыбельную: тотчас же четыре аллегорические фигуры - Ночь, Тайна, Секрет и Сон - приближаются, чтобы выполнить ее приказания. ...

Еще в разделе: (Показать все результаты (>76) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Hystory.
• C. Gibbons, M. Locke: Cupid and Death - Entry 4
• J.-B. Lully: Cadmus et Hermione - Acte V

University Satellites and . Space Science Education . ... The project of the scientific - educational small satellite for research of Earth upper atmosphere density . ... At the end of 80th years in Kuybishev aviation institute (nowadays the Samara State Aerospace University) has been developed the project of small spherical satellite " PION ", intended as for a calibration of ground resources of tracing behind space objects, and for refinement of density of upper atmosphere of the Earth. ...

Еще в разделе: (Показать все результаты (>50) - cosmos.msu.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>5) - swx.sinp.msu.ru/ )

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>137) - bioinf.fbb.msu.ru/ )

• SDPlight

Russian Journal of Electrochemistry, Vol. 37, No. 12, 2001, pp. ... CHRONICLE Yurii Aleksandrovich Chizmadzhev An outstanding Russian scientist, the corresponding member of the Russian Academy of Sciences Yurii Aleksandrovich Chizmadzhev marked his 70th birthday on December 15, 2001. ... In the Chizmadzhev laboratory, prime attention was devoted to an electroporation phenomenon, i.e. to the origination and development of micropores under the action of electric field. ...

Еще в разделе: (Показать все результаты (>80) - electr003.chem.msu.ru/ )

• Veronika K. Laurinavichyute overflow
• Vladimir Sergeevich Bagotsky
• Veronika K. Laurinavichute: Selected Publications

... ATOMS, MOLECULES, OPTICS Practical Implementation of Multilevel Quantum Cryptography S. P. Kulika,*, G. A. Maslennikovb, and E. V. Morevac Moscow State University, Moscow, 119992 Russia National University of Singapore, Singapore, 119077 Republic of Singapore c Moscow Engineering Physics Institute ( State University), Moscow, 115409 Russia *e-mail: skulik@qopt. phys .msu.su b a Received October 14, 2005 Abstract--The physical principles of a quantum ... D. Bruss, Phys. Rev. Lett. ...

Еще в разделе: (Показать все результаты (>136) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/kulik/Papers/JETP10_02BurlakovLO.pdf
• http://qi.phys.msu.su/papers/2006-pra-73-063810.pdf
• http://qi.phys.msu.ru/papers/2011-jetpl(e)-94-262.pdf