Euro-Asian Astronomical Society . International Astronomy Olympiad . 1997 . ... The II-nd International Astronomy Olympiad was organized at the Special Astrophysical Observatory of the Russian Academy of Sciences (SAO RAS) on October 21-28, 1997. ... Excursions . ... Those who are interested to get further information about the future International Astronomy Olympiads (including official invitations for teams and observers) are welcome to contact Coordinating Council in English or Russian . ...

Еще в разделе: (Показать все результаты (>4) - www.issp.ac.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

Serge Moscovici . Social Representations mailing list 1 postings, 28 Apr - 27 May 1997 . ... Deriabin wonders why social constructionism and social representations do not get close to one another. ... I cannot see where and how the theory of social representations has been rewritten to fit the cognitive paradigm. ... What is important for me now, at this point of my thinking, is the following: without a theory of social representations, we cannot understand social construction. ...

Еще в разделе: (Показать все результаты (>13) - psyberlink.flogiston.ru/ )

... A p P EC Astropar ticle Physics for Europe Ї Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) Ї Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) Ї High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) Ї Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe Ї Cosmic rays: ґ ґ ґ ґ ґ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>6) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... Michail A. Ormont Research activity of the group is related to the theory of transport and optical properties of disordered semiconductors, in particular, the disorder effects in systems of reduced dimensionality. Studies of phonon-assisted hopping transport include the theory of hopping in quasi-one- and quasi-two-dimensional systems and hopping thermoelectric effects. ... Anisotropy in hopping conductivity of quasi-one-dimensional systems. ... Electronic Superstructures in Doped Superlattices. ...

Еще в разделе: (Показать все результаты (>71) - scon155.phys.msu.su/ )

• Direct determination of the shape of potential well for off-center Ge atom in
• Conduction in Granular Metals: Virtual State-Assisted Hopping

... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... TPPMKOP is an utility developed for the automatic topology generation working well with OPLS-AA force field. ... This database is continually upgrading by our research group. ... OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 8th, 2016 4:27 дп) . ... All-atom automatic OPLS-AA topology generator . ...

Еще в разделе: (Показать все результаты (>44) - erg.biophys.msu.ru/ )

• Visual approach to construction of &QMMM section of CP2K input file ERG
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• Reaction-diffusion systems in 2D space with python ERG Research Group:

.

Еще в разделе: (Показать все результаты (>5) - lab110.imec.msu.ru/ )

Programs of General Courses . ... Instrumenta Studiorum . Historical Education Programs of General Courses . ... The handbook of programs of general courses is composed for students of the historical faculty of Moscow State University. ... 1st Course: . ... Contemporary History of Europe and America, History of Southern and Western Slavs (6th century - late 20th century), Methodological Problems of Historical Research, Foreign Languages. 5th Course: . ... Copyright 1999--MSU History Faculty ...

Еще в разделе: (Показать все результаты (>4284) - www.hist.msu.ru/ )

• Электронная образовательная среда исторического факультета МГУ имени

SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...

Еще в разделе: (Показать все результаты (>10) - mouse.belozersky.msu.ru/ )

• PLANdbAffy: probe-level annotation database for Affymetrix expression
• MTPro

... Nobels for a Strange Universe . ... Credit Copyright: High-Z Supernova Search Team , HST , NASA Explanation: Thirteen years ago results were first presented indicating that most of the energy in our universe is not in stars or galaxies but is tied to space itself. ... Over the past thirteen years , independent teams of astronomers have continued to accumulate data that appears to confirm the existence of dark energy and the unsettling result of a presently accelerating universe . ...

Еще в разделе: (Показать все результаты (>224) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Астронет > Signals of a Strange Universe
• Астронет > Эволюция соотношения Талли-Фишера

. звоните, мы в Москве(926)6667253 art-sale@mail.ru . Main page Catalogue . Your account | Shopping Cart | Cash box . Search . Languages . Welcome back ! . eMail Address: . Password: . Password forgotten? . Quick purchase . Please enter the article number from our catalogue. Welcome . Если буквы на этой страничке на русские- . Нажмите слева внизу на РУССКИЙ ФЛАГ . eCommerce Engine 2004 xt:Commerce . Русификация' исправления и дополнения . Студия Дмитрия Годунова

Еще в разделе: (Показать все результаты (>26) - www.bukivedi.ru/ )

• www.99ru.ru -

... E-Mail: admin@fadr.msu.ru . Web-development . ... Colocation at the FADR Data Center. Due to the boom in Russian language web site traffic and especially web sites devoted to Russian agribusiness, the Foundation for Agrarian Development Research offers you web-hosting and colocation services at our data center in the Moscow State University Science Park. ... You can place in our data center a single server, a server system created from your own equipment or you can rent a server from us. ...

Еще в разделе: (Показать все результаты (>20) - www.fadr.msu.ru/ )

• CCI Ag Initiative Russian Publications

Избранные научные журналы . Импакт фактор научных журналов в 2003 . Для перемещения по списку журналов в алфавитном порядке нажмите нужную букву . ... 1,825 LANGUAGE AND COGNITIVE PROCESSES . 0,250 LANGUAGE & COMMUNICATION . 0,419 LANGUAGE AND SPEECH . 0,680 LANGUAGE LEARNING A JOURNAL OF RESEARCH IN LANGUAGE STUDIES . ... 1,216 LASERS IN MEDICAL SCIENCE . ... LEARNING & BEHAVIOR . 4,444 LEARNING & MEMORY . ... Создана 8 Ноября 2004, В. И. Мельгунов, 2004 Все права защищены. ...

Еще в разделе: (Показать все результаты (>20) - www.genebee.msu.ru/ )

... Comments: 4 pages, 1 figures, appears in "Neutron Stars in Supernova Remnants" (ASP Conference Proceedings), eds P. O. Slane and B. M. Gaensler, 200 . Дается короткий обзор наблюдений остатков сверхновых на спутнике ROSAT. ... astro-ph/0208498 . ... Открытие разрешенного остатка сверхновой в M31 с борта Chandra (The Discovery of a Spatially-Resolved Supernova Remnant in M31 with Chandra) . ... Нейтронные звезды в остатках сверхновых и снаружи (Neutron Stars in Supernova Remnants and Beyond) . ...

Еще в разделе: (Показать все результаты (>395) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/bethe.pdf
• http://xray.sai.msu.ru/~polar/sci_rev/0608.html
• http://xray.sai.msu.ru/~polar/sci_rev/2002-07_2003_03/num.html

The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda Ї Ї Ї Ї Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design Ї Large caches ґ Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU Ї Sophisticated control ґ Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/presentations/MSU-Lecture-CUDA-Intro-2012.pdf
• http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D? experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>17) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf
• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf

. 21.04.2014-23.04.2014 . Вход . Enter .

180. http://dfgm.math.msu.su/files/koudr/publ.pdf