... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>29) - acoustics.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Dagesyan, S., Stepanov, A., Soldatov, E., and Snigirev, O. Properties of extremely narrow gaps between electrodes of a molecular transistor.  Journal of Superconductivity and Novel Magnetism  (2014). DOI  ] . Dagesyan, S., Stepanov, A., Soldatov, E., and Zharik, G. High-temperature single-electron transistor based on a gold nanoparticle. ... 94400P?1?94400P?6. ... Dagesyan, S., Stepanov, A., and Soldatov, E. Forming extremely small gaps in metal nanowires and studying their properties.  ...

Еще в разделе: (Показать все результаты (>6) - cryolab.phys.msu.ru/ )

• Oleg V. Snigirev

... Departments . ... Knizhnikov Y.F. (aerospace stereo modeling, remote sensing), Doctor of Geography; . ... Advanced research is in the field of further development and integration of geographic cartography theory and methods, geoinformatics and remote sensing; the use of satellite and aircraft monitoring in geography and cartography; creating regional and local GIS; WEB- mapping; satellite positioning systems; the development of geographic information and online technologies, thematical geoportals. ...

Еще в разделе: (Показать все результаты (>25) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• Education
• Postgraduate study

... Millenium Development Goals) Ї Calls have an emphasis on 6 KBBE ґ Interest for Russia Ї All topics open for Russian participation Ї Topics of particular interest may include : ґ Insects as novel sources of protein SICA [ Topic : KBBE.2012.2.3-05] ґ African Swine Flu - Russia targeted [ Topic : KBBE.2012.1.3-02] ґ Global Food Safety - targeted to international partners [ For all fields of research, from Social sciences and Humanities to Life Sciences and Physical Sciences. ...

Еще в разделе: (Показать все результаты (>24) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/call_StG_2012.pdf
• http://ideas.msu.ru/docs/press_release_2011.pdf
• http://ideas.msu.ru/docs/press_release_StG_2012.pdf

Short intro duction Dual approach Voronoi's metho d of canonical scaling Gain function Parallelohedra and the Voronoi Conjecture Alexey Garb er Bielefeld University Novemb er 28, 2012 A.Garb er Parallelohedra and the Voronoi Conjecture Short intro duction Dual approach Voronoi's metho d of canonical scaling Gain function Parallelohedra Denition Convex d -dimensional p olytop e P is called a parallelohedron if Rd can b e (face-to-face) tiled into parallel copies of P . ... F the gain function g on F . ...

Еще в разделе: (Показать все результаты (>59) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/garber/talks/2013Berlin.pdf
• C*-algebras and elliptic theory - III: Schedule
• Topology section

... Not until everyone ... by the Customs Authorities were passengers allowed to enter the country. had searched . ... Were ... being robbed . ... Peter is not ... he seems. so self-confident like . ... The more you read in English, .... your command of the language will be better . will be better your command of the language . the better your command of the language will be . your better command of the language will be . ... The food is ... and it tastes .... quite expensive ... badly . ...

Еще в разделе: (Показать все результаты (>5) - anazarenko.ffl.msu.ru/ )

Мультикластерная модель легких ядер . ... Voronchev V.T., Krasnopolsky V. М ., ... states of light nuclei in a three-body model on the complete basis. ... Voronchev V.T., Krasnopolsky V.M., Kukulin V.I., Sazonov P. В . ... nuclei in the ?+ ... Kukulin V.I., Krasnopolsky V.M., Voronchev V.T., Sazonov P. В . ... structure of light nuclei in the three-body model. ... Kukulin V.I., Pomerantsev V.N., Razikov Kh.D., Voronchev V.T., Ryzhikh G.G. Cluster structure of light nuclei in a three-body model. ...

Еще в разделе: (Показать все результаты (>56) - danp.sinp.msu.ru/ )

• Сотрудниками лаборатории были написаны книги по теории атомного ядра

... Electronic journal Issue 4. 10 september 2004 Ulrich M. Sustainable Management of Natural Resources Introduction. ... To learn about the dynamics of natural resource management and the tragedy of the commons by means of a direct experience in the simulation game ?NEW COMMONS GAME?. ... 2) Tragedy of the commons and management of natural resources. ... The simulation game was followed by a short debriefing on the dynamics of the tragedy of the commons and natural resource management. ...

Еще в разделе: (Показать все результаты (>6) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ґ velocity potential, H ґ depth, ґ vector of bottom deformation, 0 ґ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>13) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf

Trimmed estimators for robust averaging of eventґrelated potentials Zbigniew Leonowicz 1, Juha Karvanen and Sergei L. Shishkin 2 Laboratory for Advanced Brain Signal Processing, RIKEN Brain Science Institute, Saitama 351-0198, Japan Abstract Averaging (in statistical terms, estimation of the lo cation of data) is one of the most commonly used pro cedures in neuroscience and the basic pro cedure for obtaining event-related p otentials (ERP). ... Median averaging enhanced strongly the noise. ...

Еще в разделе: (Показать все результаты (>27) - brain.bio.msu.ru/ )

• http://brain.bio.msu.ru/papers/Kaplan_Roeschke_Darkhovsky_Fell_2001_JNSciMeth_MacrostructChangePointSleep.pdf
• Alexander Kaplan * Александр Каплан
• Change-points at different levels of the hierarchy of EEG segmental...

... Новости лаборатории . ... Romanova N.A., Fritz M.A., Tamm N.B., Troyanov S.I. Synthesis and X-ray structure of C 2 -C 84 (22)(CF 3 ) 6 , Mend. ... 2014) 24 , 78-79 DOI . ... Konarev D.V., Romanova N.A., Panin R.A., Goryunkov A.A., Troyanov S.I., Lyubovskaya R.N. Magnetic coupling and optical properties of the S 6 -dodecakis(trifluoromethyl)fullerene radical anions in the layered salt (PPN + )[C 60 (CF 3 ) 12 .- ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет ....

Еще в разделе: (Показать все результаты (>3) - thermolab.chem.msu.ru/ )

... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...

178. http://dbserv.sinp.msu.ru/RSWI/sun.pdf

179. Department of Mathematical Physics | CMC MSU

180. Europrobe2