... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
ЛАБОРАТОРИЯ . АВТОМАТИЗИРОВАННЫХ . ... 20 1 3 г. 20 1 2 г. 20 1 1 г. 20 1 0 г. 2008 г. 2007 г. Публикации сотрудников лаборатории 2009 г. Сборники . ... Рафаева А.В. Научная, "наивная" и фольклорная картина мира // Педагогические технологии. ... Kazakevich, Olga. Language changes speeded up // The 16 th World Congress of the International Union of Anthropological and Ethnological Sciences. ... The 16 th World Congress of the International Union of Anthropological and Ethnological Sciences. ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
Uneex . SeminarTraffic . ... Анализ трафика -- зачем это нужно. ... Источники информации о трафике. ... Cisco accounting и NetFlow ( вот тут информации недостаточно, если кто-то может рассказать про эту часть -- хорошо ). ... В формате SXI (ooImpress) . ... Обзор биллинговых систем и систем учета трафика: http://www.opennet.ru/prog/sml/47.shtml . ... Интересная разработка: система адаптивного агрегирования информации о трафике. http://camelot.iki.rssi.ru/RFFI-02-07-90390 . ... Action: . ...
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
Division of Geology . ... Division of Hydrogeology and Engineering Geology . ... Faculty of geology > English > Divisions & Departments . ... The graduates of "Engineering geology" specialization must have a vast geological background and know the state-of-the-art methods of studies and forecast of engineering-geological conditions for industrial, urban, hydrotechnical, road and underground construction. ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. ...
... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
Evolutionary Ecology 1998, 12, 291±307 Evolutionarily optimal age schedule of repair : Computer modelling of energy partition between current and future survival and reproduction ANATOLY T. TERIOKHIN Department of Biology, Moscow State University, Moscow 119899, Russia Summary The aim of this study was to ... Let us now look at the inЇuence of the level of external mortality, associated with the parameter , on the optimal energy partition between reproduction and current survival. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1998_Repair_EvolEcol.pdf -- 675.3 Кб -- 16.03.2009 Похожие документы
... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...
... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...
... Widgetkit is the next generation tool set for Joomla and WordPress. ... All widgets make use of modern web technologies like HTML5 markup, CSS3 features and jQuery based JavaScripts. ... It supports touch gestures and makes use of smooth CSS3 animations. ... Semantic HTML5 markup . ... You can create, edit or delete all widgets and their content in one place. ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...
... Язык для специальных целей . Язык для академических целей . ... Кафедра . ... П од языком для специальных целей понимается набор языковых единиц разных уровней (прежде всего лексического), посредством которых специалисты в той или иной профессиональной сфере могут передавать сообщения специального характера. ... Английский язык для механиков и математиков (2-е издание) . ... Русско-английский математический словарь-минимум . ... Кафедра английского языка механико-математического факультета. ...
... Here is a brief outline of the current theory of the events in the early history of the solar system: . A cloud of interstellar gas and/or dust (the "solar nebula") is disturbed and collapses under its own gravity. ... The gas cools off enough for the metal, rock and (far enough from the forming star) ice to condense out into tiny particles. (i.e. some of the gas turns back into dust). ... Once the larger of these particles get big enough to have a nontrivial gravity, their growth accelerates. ...
... Настоящим выпуском антропологи МГУ объявляют о появлении нового издания 'Вестник Московского университета. Серия ХХIII. Антропология'. ... В продолжение традиций мы надеемся, что 2009 год станет годом обновления Музея антропологии Московского университета, который откроется в Старом здании на Моховой после ремонта и реконструкции. ... Балахонова Е.И. Африканские коллекции из Московского Публичного и Румянцевского музея в Музее антропологии МГУ. ... А.Л. Пурунджан (1947-2009) Открыть . ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... Is it necessary to do the beam weaker? ... Q: If the mixture of powders consists of both isotropic and anisotropic particles, is it possible to estimate the ratio of isotropic and anisotropic parts? If I understand the question correctly, one asks, if one has a fraction of oriented anisotropic particles and a fraction of the disoriented anisotrpic particles (i.e. one has somewhat partial texture in the powder sample), then is it possible to find out these fractions? ...