... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

Еще в разделе: (Показать все результаты (>2) - lib.sinp.msu.ru/ )

... Our understanding of quantum gravity suggests that at the Planck scale the usual geometry loses its meaning. ... Singular unification: an unification of all fundamental interactions at the Planck scale in the form of a Universal Landau Pole (ULP), at which all gauge couplings diverge. ... The unification is achieved with the addition of fermions with vector gauge couplings coming in multiplets and with hyp ercharges identical to those of the Standard Mo del. Stability of the Higgs Potential. ...

Еще в разделе: (Показать все результаты (>120) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks/Bunichev_singletop_tWb_LHC.pdf
• http://qfthep.sinp.msu.ru/talks2011/abssochish.pdf

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>12) - erp.cmc.msu.ru/ )

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>23) - www.kge.msu.ru/ )

• Научная информация
• Chemistry Journals

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>59) - www.msm.biophys.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Pension funding . ... Paris, 2000,-427 p. Insurance . ... Mixture . ... Continuous Mortality Investigation Reports, Num.12, Institute of Actuaries and the Faculty of Actuaries, 1991,-263 s. Actuarial Mathematics . ... Continuous Mortality Investigation Reports, Num.16, Institute of Actuaries and the Faculty of Actuaries, 1998,-181 s. Actuarial Mathematics . ... Continuous Mortality Investigation Reports, Num.17, Institute of Actuaries and the Faculty of Actuaries, 1999,-231 s. Actuarial Mathematics ...

Еще в разделе: (Показать все результаты (>46) - new.math.msu.su/ )

• A.Yu. Veretennikov

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

... American), headings and the style of referencing. ... The opening page of a contribution in the NATO book series should always be a right hand page and should consist of: the title in capital letters, bold font, flush left, on the fourth text line; followed by the subtitle (if present) in italics, flush left, with one line of white above. ... First-order Heading This heading is in bold, upper and lowercase letters, numbered in arabic figures, and has two lines of space above and one line below. ...

Еще в разделе: (Показать все результаты (>121) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2007/shcherbina-reduction-2007.pdf
• MGUMUS -- Current projects

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

• Guidelines

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>18) - dynamo.geol.msu.ru/ )

... 231 Mathematical Statistics and Problems of Ancient Chronology. ... The methods are applied to the problem of correct dating of the events in ancient chronology. These results induce conjecture on the redating of some historical events. ... We call such texts statistical duplicates. ... Fomenko, A. T.: New Experimental and Statistical Methods for Dating Events of Ancient History and Applications to Global Chronology of Ancient World and Middle Ages, British Library, Dept. of Printed Books, Cup. ...

Еще в разделе: (Показать все результаты (>100) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/articles/ligorep97.pdf
• http://hbar.phys.msu.ru/gorm/ahist/antikythera2.pdf
• http://hbar.phys.msu.ru/gorm/dating/vesuvius.pdf

Souviens-toi , c'Иtait un jeudi Souviens-toi , on avait suivi Le chemin des amoureux C'Иtait il Иtait une fois nous deux Souviens-toi , c'Иtait le grand jour Le grand pas vers le grand amour C'Иtait encore mieux que Гa C'Иtait nous deux il Иtait une fois Un mТtel sur la route du port Un soir banal Deux clients, un veilleur qui s'endort Sur son journal Il ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

... Alexey Andreev БЂ“ Deputy Dean of the General Affairs and Strategic Development of the Faculty of Global Studies MSU, Associate Professor . ... School of Young Specialist at International Relations and preparatory courses of the Faculty of Global Studies are running. п п°п±пѕя‚п°пµя‚ я€пєпѕп»п° яЋпЅпѕпЕпѕ пјпµп¶пґяѓпЅп°яЂпѕпґпЅпёпєп° пё пїпѕпґпЕпѕя‚пѕпІпёя‚пµп»яЊпЅя‹пµ пєяѓяЂяЃя‹ я„п°пєяѓп»яЊя‚пµя‚п° пЕп»пѕп±п°п»яЊпЅя‹я… пїяЂпѕя†пµяЃяЃпѕпІ пјпЕяѓ . ... Home Search results for ' ' (Page 208) . ...

Еще в разделе: (Показать все результаты (>1559) - fgp.msu.ru/ )

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )