... За последние несколько лет члены GMRG опубликовали множество значимых работ, в том числе антологию The Discourses and Politics of Migration in Europe (Palgrave, 2013), статьи в Journal of European Public Policy и специальный выпуск Comparative European Politics (2015), посвященный крупным политическим партиям и миграционной политике в Европе. ... Bucken-Knapp G., Hinnfors J., Spehar A. Political Parties and Migration Policy Puzzles // Comparative European Politics. ... Bucken-Knapp G. Book Review. ...
Sbornik : Mathematics 201:3 117 Matematicheski Sbornik 201:3 320 i c 2010 RAS(DoM) and LMS DOI 10.1070/SM2010v201n03ABEH004074 Elementary equivalence of Chevalley groups over lo cal rings E. I. Bunina Abstract. It is proved that (elementary) Chevalley groups over local rings with invertible 2 are elementarily equivalent if and only if their types and weight lattices coincide and the initial rings are elementarily equivalent. ... Keywords: Chevalley groups, elementary equivalence, local rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:bunina_proofs.pdf -- 314.0 Кб -- 13.02.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
. Lab . Main page News People . ASA . Master . Master net Homepage . Login . Enter your username and email address. Your new password will be sent to your email . Username: . Email: .
Аннотированные англоязычные сокращения . ... программа решения пятидиагональных несимметричных линейных систем со спектром, лежащим в полуплоскости Re; реализует алгоритм Мантеффеля; имеется возможность для ускорения сходимости использовать стабилизированное частичное LU - разложение матрицы системы; разработана в ACCU, Нидерланды . ... пакет программ для решения систем линейных алгебраических уравнений итерационными методами, разработанный в университете штата Техас в г.Остине, США . ...
... Душа самосознающая / Сост. и вступ. ст. ... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Единство моих многоразличий:' Неотправленное письмо Сергею Соловьеву / Публ., вступ. ст. и коммент. ... Серебряный голубь: Рассказы / Сост., предисл., коммент. ... Сост. ... Бердяев Н. Письма Андрею Белому / Предисл., публ. и примеч. ... Робакидзе Г. Письма Андрею Белому / Публ. и предисл. ... Предисловие' А.Белого к неосуществленному изданию романа 'Котик Летаев' / Публ., вступ. ст. и коммент...
ANTARES Collaboration Meeting . ... Group photo in front of Lomonosov monument and MSU Main Building . ... We are pleased to welcome you to Moscow State University, where June 6-10, 2011 the ANTARES Collaboration Meeting will be held. Moscow State University is one of the tourist attractions of Moscow, an architectural monument and the tallest university building of the world. ... Antonio Capone, Physics Department University "Sapienza" and INFN, Roma . ... Salvatore Mangano, IFIC-CSIC, Valencia . ...
... Клуб выпускников / Члены клуба / Обновление данных . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . Если Вы забыли пароль, укажите ФИО и факультет, и пароль будет выслан на Ваш e-mail. ...
... О Центре . ... Открытие Центра . ... Технологии Intel . Технологии программирования . ... Технологии Intel в основе учебного процесса . ... подробной технической информации о разработке игр, мультимедийных приложений, решений для совместной работы и финансового ПО; . ... Страница Центра компетенции (ЦК) СО РАН-Intel по высокопроизводительным вычислениям. Репортаж об официальном открытии Центра . ... Зарегистрируйтесь на сайте поддержки продуктов . ... на сайт поддержки. ...
... Отмеченная наградами АстроТоп-а . ... Анатолий Анатольевич Волчков . ... кто-то из великих) Я долго подбирал название для этой мемориальной статьи об Анатолии Анатольевиче Волчкове. ... Какие только названия не приходили ко мне в голову - "Легенда об Анатолии", "Исполнить миссию", "Человеко-форум", "Камертон Астрорунета".. ... P.P.S. 31 декабря 2003 г. решением команды проекта Астротоп принято решение - "признать Анатолия Волчкова Человеком года " в традиционных конкурсах Звезды АстроРунета-2003 . ...
... It was necessary to construct quite a different type of parachute to be light, compact, encased in a parapack and reliable. At first most parachute designers considered it to be hardly possible for a canopy to open in the air without the aid of some special devices, such as an umbrella spokes, compressed air or powder explosive charges. ... Later on a great number of different parachute systems were worked out and introduced by Russian parachute designers Nikolai Lobanov, Igor Glushkov and others. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...
... 2 · , , · · , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...
... Лекции . ... Бакинский филиал МГУ . ... Это сайт для тех, кто изучает или преподает Физическую Химию: химическую термодинамику и химическую кинетику. На сайте помещены лекции по Физической химии для студентов Химического факультета МГУ (Общий курс), лекционные презентации и материалы для подготовки к экзаменам. ... 09.04.16 Новый вариант лекции 15 весеннего семестра. ... 09.02.16 Исправленный вариант лекции 13 осеннего семестра . ... Химфак МГУ . ... 2014-2016 ћ Лекции по физической химии . ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....