... Department of Chemistry, Lomonosov Moscow State University, 1974 . Academic degree . ... D. (Organic Chemistry), 1985 . ... Leading Researcher, Head of Laboratory . ... Department of Chemistry, Lomonosov Moscow State University, Leninskie gory 1/3, Moscow 119991 Russia . ... organic chemistry, medicinal chemistry, chemoinformatics, QSAR, organic synthesis, conformation analysis, computer-aided drug design, molecular modeling, receptors, docking, virtual screening, mathematical chemistry . ...

Еще в разделе: (Показать все результаты (>24) - qsar.chem.msu.ru/ )

• Orlov, Alexey A. - Laboratory of Medicinal Chemistry
• Voronkov, Andrew E. - Laboratory of Medicinal Chemistry
• Karpov, Pavel V. - Laboratory of Medicinal Chemistry

Victor A. Safonov . ... Department of Electrochemistry . ... M.V.Lomonosov Moscow State University . ... Junior Scientific Researcher, Associate Professor, Leading Scientific Researcher, Principal Scientific Researcher Department of Electrochemistry, Faculty of Chemistry, M.V. Lomonosov Moscow State University . ... Specific features of the double electrical layer structure at the interface of alloy electrodes with electrolyte solutions (kinetics and mechanism of surface segregation processes) . ...

Еще в разделе: (Показать все результаты (>74) - electr003.chem.msu.ru/ )

• Pronkin Sergey Nikolayevich
• Laboratory of Electrical Double Layer and Electrode Kinetics
• Maria A. Choba:CV

... About Us . ... Research . ... Besides History students, it taught English to Law, Economics and Philosophy students. At present, the Department of English for the Humanities is an integral part of the Faculty of Foreign Languages and Area Studies. At the department, the English language is taught to both undergraduates and postgraduates (at Masters and Doctoral level) from the following faculties: . ... Our academic staff are committed to the highest standards of teaching and research. ...

Еще в разделе: (Показать все результаты (>100) - ffl.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>26) - mailybaev.imec.msu.ru/ )

• Curriculum Vitae of Dr Alexei A

... M. V. Lomonosov Moscow State University . ... M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ... PhD at the Department of Electrochemistry, M.V.Lomonosov Moscow State University . ... S.Trasatti, O.A.Petrii, "Real surface area measurements in electrochemistry" J.Electroanal. ... O.A.Petrii, S.Ya. ... O.A.Petrii, G.A.Tsirlina, T.V.Rakova, S.Yu.Vassiliev, "Anomalous features of thallium oxide electrodeposited layers and room temperature HTSC electrosynthesis", J.Appl. ...

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

Psychology in Russia: State of the Art Ї 2009 Child's at taChment to mother as the basis of mental development typology Galina V. Burmenskaya Lomonosov Moscow State University Moskow The article shows the role of the attachment system (child-mother interactions) in development of a wide spectrum of individual personality characteristics. ... Type of emotional self-regulation; 3. ... On the whole, children with insecure types of attachment show more autonomy than children with secure attachment. ...

Еще в разделе: (Показать все результаты (>165) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/people/krivitsky/krivitsky2007.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-2/kaczmarek_2013_2.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_150-163.pdf

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>8) - photonicslab.phys.msu.ru/ )

• Contacts

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>58) - eng.geogr.msu.ru/ )

• Khibiny teaching and research station
• Arkhangelsk (Ustiayansk) station

... West European and American literature and culture of XIX-XX centuries, literature as discourse, reception studies, history of the book . ... Moscow University Press, 1994. ... W. Stevens. тАУ History of American Literature. ... Board Member, Administrative Board of Moscow University . Board Member, Administrative Board of the School of Philology, Moscow University . Board Member, Specialized Dissertation Board for West-European and Slavic Literatures, School of Philology, Moscow University . ...

Еще в разделе: (Показать все результаты (>18) - discours.philol.msu.ru/ )

• Maria Soukhotina

... Deputy deans . ... Alexey Andreev Б€? Deputy Dean of the General Affairs and Strategic Development of the Faculty of Global Studies MSU, Associate Professor . ... School of Young Specialist at International Relations and preparatory courses of the Faculty of Global Studies are running. п?п°п?пЎя?п°п?я? я?п?пЎп?п° я?пҐпЎпЕпЎ п?п?пІпЄя?пҐп°я€пЎпЄпҐп?п?п° п? п©пЎпЄпЕпЎя?пЎп?п?я?п?п?я?пҐя?п? п?я?я€я?я? я?п°п?я?п?я?я?п?я?п° пЕп?пЎп?п°п?я?пҐя?я? п©я€пЎя?п?я?я?пЎп? п?пЕя? . ... Home featured post (Page 46)...

Еще в разделе: (Показать все результаты (>1643) - fgp.msu.ru/ )

... О Школе . ... ВШБ МГУ - школе . ... Выпуски журнала . Выпуск 1/2009 Выпуск 1/2010 Выпуск 2/2010 Выпуск 1/2011 Выпуск 2/2011 Выпуск 1/2012 Выпуск 2/2012 Выпуск 1/2/2013 Выпуск 1/2/2014 . ... Менеджмент Выпуски журнала Выпуск 1/2/2014 . ... Эволюция моделей бизнеса в киноиндустрии России . ... Автор рассматривает формы международных проектов, существующие в мировой образовательной практике, а также делится опытом их реализации в Высшей школе бизнеса МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>159) - www.mgubs.ru/ )

• The Ljubljana Summer school

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

... List of all selected researchers by country of host institution (in alphabetical order within each country group): http :// erc.europa.eu / pdf / ERC _StG2010Results_All_by_Country. pdf Lists of selected researchers by domain (in alphabetical order): Social Sciences and Humanities: http :// erc.europa.eu / pdf / ERC _StG2010Results_SH. pdf Life Sciences: http :// erc.europa.eu / pdf / ERC _StG2010Results_LS ... Calls for proposals: published annually in summer with deadlines in autumn. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://www.msu.ru/int/newpr/7ram/7ram_budz.pdf
• http://www.msu.ru/int/newpr/7ram/7ram_napr.pdf

... О кафедре . ... Завершился курс "Методы лабораторных зоологических исследований", впервые проводимый в этом году. ... 11-й Морской семинар! Продолжить чтение . 31 марта 2016 (четверг), 13:00, 594 ауд. - заседание кафедры . ... Десятый семинар центра морских исследований МГУ . ... Девятый семинар центра морских исследований МГУ . ... JavaScript must be enabled in order for you to use Google Maps. However, it seems JavaScript is either disabled or not supported by your browser. ...

Еще в разделе: (Показать все результаты (>3) - invert.bio.msu.ru/ )

• История кафедры
• Учебный процесс

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ґ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ґ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Студенческий форум Физфака МГУ > Общий > ТРЕП . ... Полный беспредел http://youtube.com/watch?v=5ZLBixLazZs&feature=related . ... На нашем форуме уже было, но ссылку впихну: http://youtube.com/watch?v=1u-jamdlQfY - это печально! ... Предвыборная речь мэра Харькова: http://youtube.com/watch?v=Poyb8ewSADQ . ... http://www.youtube.com/watch?v=Q8-F-RWPv1U . ... http://www.youtube.com/watch?v=nV-hEXeCs-k...feature=related . ... http://www.youtube.com/watch?v=m_65rKRoC6s...feature=related . ...

Еще в разделе: (Показать все результаты (>493) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Перспективная работа в иностранной компании
• Студенческий форум Физфака МГУ > RedHat про Sun & Micro$oft
• Студенческий форум Физфака МГУ > Короткое Замыкание, Горение дуги,

... Staff . Publications . ... Conferences . ... Author and editor inТ ICS (ICS series Т?Contemporary MathematicsТЛ, Т?Computing inТ Mathematics, Physics and BiologyТЛ) . Member ofТ the editorial board ofТ Т?Regular  Chaotic DynamicsТЛ . ... A.Bolsinov@lboro.ac.uk . Qualitative theory ofТ integrable Hamiltonian systems . ... Features ofТ Lagrange foliations . ... Computer geometry . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>104) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Kozlov Valery Vasilevich

. This document is designed to be viewed using the frames feature. If you see this message, you are using a non-frame-capable web client. Link to Non-frame version.

Еще в разделе: (Показать все результаты (>19) - angel.cs.msu.su/ )

... A new method is proposed that makes it possible to determine the parameters of the three-dimensional (3D) multiwell potential of off-center atoms from extended X-ray absorption fine-structure (EXAFS) data. ... The parameters of the multiwell potential for Ge atoms in the Sn 1-x Ge x Te solid solution as functions of temperature and composition (77<T<300 K, x>0.4) were obtained in the classical approximation. ...

Еще в разделе: (Показать все результаты (>71) - scon155.phys.msu.su/ )

• The Physics of Semiconductors division of MSU
• Program of the 5th Russian-Japanese Symposium on Ferroelectricity (Moscow,
• Influence of random fields on the ferroelectric phase transition in IV-VI