... 2012/10/18 . GTOPO30 is a global digital elevation model (DEM) with a horizontal grid spacing of 30 arc seconds (approximately 1 kilometer)? (http://eros NULL .usgs NULL .gov/#/Find_Data/Products_and_Data_Available/gtopo30_info) . ... You can follow any responses to this entry through the RSS 2.0 feed. ... 2014/11/12 at 1:03 am . trusted@pillspot.com (http://trustedpillspot NULL .com/?p=777&lol= ? ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>7) - geo.sai.msu.ru/ )

• August 2012 Лаборатория лазерной интерферометрии
• etopo Лаборатория лазерной интерферометрии
• gmt Лаборатория лазерной интерферометрии

... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>19) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific
• Alexander Valeryevich Pozdneev
• Courses

... European Southern Observatory at Site 2010 Kislovodsk Collaboration University of Lethbridge, Canada ­ R. Querel, D. Naylor, G. Tompkins U. Valparaiso ­ A. ChacСn, O. Cuevas, M. Cure, L. Cortes, M. Caneo, L. Illanes ­ J. ThomasOsip, G. Prieto ­ A. OtАrola, M. SchЖck, T. Travouillon ­ R. Hanuschik, M. Sarazin, C. Guirao, G. Avila, G. Lo Curto, I. Saviane, A. Pizarro, G. Ihle, J. Navarette, A. Smette, D. Rabanus Site 2010 Kislovodsk, Oct 5th, 2010 2 GMT, Las Campanas TMT ESO F. Kerber et al. ...

Еще в разделе: (Показать все результаты (>25) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/Site2010-Summary.pdf
• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf
• http://site2010.sai.msu.ru/static/doc/AOtarola_site2010.pdf

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>7) - ccoe.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... California Department of Education (1985), Mathematics framework for public schools, kindergarten through grade twelve. ... California Department of Education (1992), Mathematics framework for California public schools, kindergarten through grade twelve. ... California Department of Education (February 5, 1998), The California mathematics academic content standards. [ http://www.cde.ca.gov/board.html ] . ... NCTM (1998), California mathematics academic content standarts for grades K-12. ...

Еще в разделе: (Показать все результаты (>1319) - www.nature.web.ru/ )

• Первая за последние 10 лет книга по компьютерному моделированию динамических

... Single station indices on the level of cosmic ray activity . Real time cosmic ray variation on Moscow Neutron Monitor . Apatity and Barentsburg cosmic ray stations . Arctic Center Cosmophysical Prognosis (Russian version) . Arctic Center Cosmophysical Prognosis (English version) . Data Base of Yakutsk, Tixie Bay and others neutron monitors (since Jan 1, 1980 ) . Aragats Neutron Monitor . ... Model of Galactic Cosmic Rays (SINP MSU GCR model) . ...

Еще в разделе: (Показать все результаты (>7) - dbserv.sinp.msu.ru/ )

• Links
• Magnetosphere

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

1990k: 70007 70E99 (58F40, 76D25) Samsonov V.A., Shamolin M.V. On the problem of the motion of a body in a resisting medium (Russian). ... 70: Mechanics of particles and systems. 70E: Dynamics of rigid body. ... 58F: Ordinary differential equations on manifolds; dynamical systems. ... Russian. ... 34: Ordinary differential equations. ... As applications we consider dynamical systems that describe the plane-parallel motion of a body in a resisting medium as well as various model variants of it." ...

Еще в разделе: (Показать все результаты (>67) - shamolin2.imec.msu.ru/ )

• Заседание 100 в рамках Международной конференции (Киев, 2003)
• Заседание 135 в рамках Международной конференции (Киев, 2005)
• Заседание 163 в рамках Международной конференции (Киев, 2007)

arXiv:1102.5698v1 [math.AT] 28 Feb 2011 Generalization of the Sullivan construction for Transitive Lie Algebroids Mishchenko, Alexander S. (Moscow, Russia) and Ribeiro, Jose (Braga, Portugal) March 1, 2011 1 Preliminaries and Formulation of the ... Namely, for transitive Lie algebroid A T M M one can define an underlying Sullivan model as graded algebra s (A; M ) of piecewise smooth p differential forms on smooth manifold M with smooth combinatorial structure. ...

Еще в разделе: (Показать все результаты (>155) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/garber/talks/2010Texas.pdf
• INVITED ADDRESSES:
• Mishchenko Alexandr S.

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>37) - ideas.msu.ru/ )

Chlorophyll Fluorescence in vivo : A Theory (Part I) . Most part of the photosynthetic pigments in phytoplankton cell reside in peripheral pigment-protein complexes of the light-harvesting antenna (I, see Fig. ... From peripheral antenna complexes, excitation is efficiently transferred to core antenna complexes near photosynthetic reaction centers (II, Fig. 1), where it can be used in the primary photochemical reaction of photosynthesis. ... and phytoplankton concentration . ...

Еще в разделе: (Показать все результаты (>8) - www.biophys.msu.ru/ )

• (Chlorophyll Fluorescence in vivo: A Theory
• Устинин Дмитрий Михайлович
• Сектор информатики и биофизики сложных систем

... Academic Departments . ... Partners . ... All partners . ... 07.03.2013 On March 01, 2013 Professor Francesca Romana Seganti (American University in Rome) delivered two lectures at the Faculty of Journalism, Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>69) - www.journ.msu.ru/ )

• The 5th International Media Readings in Moscow "Mass Media and Communications ?
• Title :: Department of Journalism, M. V. Lomonosov Moscow State University
• The round table ?Problems of regional television in Russia? :: Department of

You are here: Foswiki > System Web > ReferenceManual > DeveloperDocumentationCategory > PerlDoc (19 Apr 2011, ProjectContributor ) E dit A ttach . ... internal package Foswiki::Configure::UI . ... StaticMethod loadChecker($id, $item) $checker . ... ObjectMethod setting(...) $html . ... Each structural entity in a configure screen has a UI type, either stored directly in the entity or indirectly in the type associated with a value. ... Loads the Foswiki::Configure::Checker subclass for the given $id. ...

Еще в разделе: (Показать все результаты (>4533) - wiki.cmc.msu.ru/ )

• JSPopupPlugin < System < Foswiki

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>10) - lvk.cs.msu.su/ )

• Index of /~bahmurov/course_simulation/2015/

PTOLEMY'S FAILINGS . ... The Crime of Claudius Ptolemy. ... Almost as a stocktaking of Ptolemy , the 1970s saw the publication of three monographic writings on his astronomy , viz, O. Neugebauer's authoritative account of the contents of the Almagest in its context of the mathematical side of the rest of ancient astronomy , 1 O. Pedersen's Almagest companion volume designed to guide also the student of Latin astronomy up to the Renaissance, 2 and R. R. Newton's ...

Еще в разделе: (Показать все результаты (>139) - hbar.phys.msu.ru/ )