by Margarita Dzhalalova It is known that the pressure difference values for a round parachute are constant over total canopy, then for a square parachute the values of pressure difference are non-uniform along radial ribbons differing even from each other and depending mainly on certain sets of line lengths, and therefore square parachutes attain different shapes from each other ( Fig.1 - photo of var.1 and var.2). ... Distribution of pressure coefficient along radial ribbons of square parachute. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• Air-Permeability Influence on Pressure Distribution Character

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>86) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Andrei Vladimirovich Fursikov | Department: General Problems of Control.

... E-mail: ryabov@enzyme. chem .msu.su b a ,b X-Ray structural data for a,b-h,g-[Pt{o-C6H4C(Me)=NOC(=O)Me}(µ-Cl)]2 and ab initio quantum chemical calculations were used to show that the biomimetic hydrolysis of esters and amides within the coordination sphere of a square-planar complex , in general, and the deacylation of cyclometallated aryl oxime esters, in particular, is due to the stereochemical control which arises from the close proximity of the coordinated OH or H 2O ligand and the ... Chem. ...

Еще в разделе: (Показать все результаты (>120) - www.enzyme.chem.msu.ru/ )

• General Information

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>1720) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2015/10/Programme_English-2.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>54) - eng.geogr.msu.ru/ )

• Faculty of geography Lomonosov Moscow State University

... Lomonosov Moscow State Univ Research Center "Computer Science and Control" of RAS (FRC CSC RAS) Operations Research Society (RSORS) will organize the VIII Conference in Octo Operations Research. theoretical aspects and ersity (MSU), Federal and Russian Scientific ber 2016 in Moscow. ... Deadline for abstract submissions is March 31, 2016. ... Conference website: http://io.cs.msu.ru/ORM2016.html. ... Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>20) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2013/ORM2013-2nd_ann-ENG.pdf
• http://io.cs.msu.ru/ORM2016/ORM2016-2nd_announ-ENG.pdf
• Кафедра Исследования Операций

University Satellites and . Space Science Education . ... Aerospace and remote sensing education in the Geography schools of Moscow and Cambridge universities . ... The two well-known universities under comparison, namely the Lomonosov Moscow State University, and the University of Cambridge, UK have well established traditions of geographical remote sensing. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>99) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom2_2013.pdf

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ EFFECTS OF THE SEAFLOOR TOPOGRAPHY ON TSUNAMI GENERATION EXPLORED FOR THE MESSINA 1908 TSUNAMI THROUGH 2-D FINITE ELEMENT MODELING Alberto Armigliato and Stefano ... By comparing Figure 2. ... Figures 3 and 4 illustrate the surface displacements induced by the selected fault model along profiles 1 and 2, respectively. ...

Еще в разделе: (Показать все результаты (>24) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>72) - chaos.phys.msu.ru/ )

• Vertical phytoplankton profiles
• Links
• Alexey Ryabov. Research

... 000, 1­12 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...

Еще в разделе: (Показать все результаты (>10) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

... Lecture Cycle: The Cold War: US and URSS, Countercultures and Citizen Diplomacy . ... This lecture offers a comparative analysis of the cultural impact of the cold war on both countries. It then focuses on the countercultures and introduces citizen diplomacy as a bottom-up strategy to end the Cold War. ... Films for the Cold War Lecture Birgit (recommended to see) . ... Russkii vopros (UdSSR 1947; Michail Romm) . ... Sekretnaja missiia (UdSSR 1950; Michail Romm) . ... The Northstar (USA тАЩ43) . ...

Еще в разделе: (Показать все результаты (>18) - discours.philol.msu.ru/ )

• Free verse and free dance

... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...

Еще в разделе: (Показать все результаты (>4) - smu.physics.msu.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>14) - mph.cmc.msu.ru/ )

• MPH-CMC-MSU

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements

... Предыдущее сообщение: PARALLEL.RU - Новости, специальный выпуск [16/11/2010] . ... Выпуск 298 . 23 ноября 2010 г. ------------- 1 декабря 2010 заканчивается срок представления аннотаций докладов на Международную научную конференцию Параллельные вычислительные технологии (ПаВТ) 2011 . http ://agora.guru.ru/pavt ------------- На странице Научного семинара PARALLEL.RU выложены ссылки на видеозапись выступления Томаса Стерлинга в НИВЦ МГУ имени М.В.Ломоносова 1 ноября 2010 года ...

Еще в разделе: (Показать все результаты (>115) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #282 [02/03/2010]
• PARALLEL.RU - Новости, выпуск #268 [07/07/2009]
• PARALLEL.RU - Новости, выпуск #311 [08/07/2011]

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

Volume Functions of Historical Texts and the Amplitude Correlation Principle Anatoliy T. Fomenko* *Department of Mathematics and Mechanics, Moscow University, Leninskie Gory Moscow, 119889, U.S.S.R. and Svetlozar ... Santa Barbara, California 93106, U.S.A. Abstract: A new empirico-statistical model is suggested to distinguish dependent narrative texts from independent narrative texts by means of their ... A qualitative definition of rich and poor texts is intuitively clear (Figure 3). ...

Еще в разделе: (Показать все результаты (>98) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/ahist/antikythera1.pdf
• http://hbar.phys.msu.ru/gorm/dating/vesuvius_ama.pdf
• http://hbar.phys.msu.ru/gorm/ahist/antikythera3.pdf