. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>5) - www.dubinushka.ru/ )

Dear Sergey Shakin: Per mit me to comment on the accusations br ought against Academician Nekipelov, which I read on the site of Polit.ru. In the first place, it is clear that the editors, having r equested an "academic" r eview of the Nekipelov book, have stretched and abused the comments by Professor Sonin. ... The other matters -- for instance whether ther e is too much citation for a monograph -- are entir ely subjective, matters basically of academic taste. ...

Еще в разделе: (Показать все результаты (>18) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipeliv_31012011.pdf

... Sister cells with nonirradiated centrosomes and cells with partially irradiated cytoplasm were used as controls. ... Cells with irradiated centrosome survive in culture for a long time, but differ from sister and intact cells. ... The localization of B23 protein in cells with the irradiated centrosome sharply differed from that described above: in the nuclei of such cells the nucleoli were stained significantly weaker than in sister cells; besides, the karyoplasm was stained rather intensively (Fig....

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/grigoriev99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/amchencova98.pdf

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>5) - www.paleopedology.msu.ru/ )

• Inter-Congress Meetings

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>7) - erp.cmc.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific
• Courses | Department of the Automation for Scientific Research CMC MSU
• Courses

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

e-mail: varenik_ms@mail.ru) , , , , - , , , , globalization, western expansion, sociocultural element, moral values, moral premise, western civilization, national crisis, world redistribution . The author has attempted to analyze modern Russian society in the context of globalization. ... The historical analysis of the relations between Western countries and Russia emphasizes the struggle of two spiritual principles which are rooted in religion. ...

Еще в разделе: (Показать все результаты (>72) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/4/11.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/3/07.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/1/13.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>6) - depni.sinp.msu.ru/ )

... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...

171. http://beams.chem.msu.ru/doc/JAP2004_96_109.pdf

172. http://ideas.msu.ru/docs/ERC_guide_preparation.pdf

173. Кафедра общего и сравнительно-исторического языкознания филологического

174. Laboratory of laser spectroscopy of solutions of supramolecular compounds and

175. Publications of E.A.Morosova

176. Air-Permeability Influence on Pressure Distribution Character

177. http://www.rsr-online.ru/doc/2011_10_31/4.pdf

178. http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc

179. http://www.library.biophys.msu.ru/PDF/80524.pdf

180. SVETKA, a program for multiple sequence alignments analysis