... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>11) - iconolat13.phys.msu.ru/ )

• Proceedings

Intel® Fortran Compiler Options Quick Reference Guide for Linux* Systems Legal Information Copyright © 2003 Intel Corporation Document Number: 253258-001 i Intel® Fortran Compiler Options Quick Reference Disclaimer and Legal Information Information in this document is provided in connection with Intel products. No license, express or implied, by estoppel or otherwise, to any intellectual property rights is granted by this document. EXCEPT AS PROVIDED IN INTEL'S TERMS AND CONDITIONS OF SALE FOR SUCH

Еще в разделе: (Показать все результаты (>13) - www.arcetri.astro.it/ )

• APOD: June 25, 1996 - A Star Forming Region in the LMC

... Inorganic Synthesis . ... The course consists of the general laws of chemistry (principles of chemical thermodynamics, kinetics, solution theory, theory of chemical bond, structure of molecules), chemistry of elements (structure and properties of simple substances and mains of inorganic compounds, relationships of properties changes on the base of Periodic Law), reactions and methods of quality analysis. ... SPECIAL COURSE: PHYSICAL AND CHEMICAL BASES OF SOLID STATE SYNTHESIS OF INORGANIC MATERIALS ...

Еще в разделе: (Показать все результаты (>51) - www.inorg.chem.msu.ru/ )

• I n o r g a n i c C h e m i s
• Inorganic Synthesis Laboratory - Supramolecular and Cluster Compounds
• Inorganic Synthesis Laboratory

479 (2012) 183-185 Contents lists available at SciVerse ScienceDirect Physica C journal h omepage: www.else vier.com/locate/physc Near-field optical microscopy of plasmonic effects in anisotropic metamaterials M.R. Shcherbakov a,, B.B. Tsema a b c a,b , Yu.B. Tsema a, A.A. Ezhov a, V.I. Panov a, D.P Absolute measurements of near-field linear dichroism are performed for an array of plasmonic nanowires by measuring the linear dichroism value at the edge of the sample. ... 1о? aei/ ?b0 sin h ? ...

Еще в разделе: (Показать все результаты (>43) - nanolab.phys.msu.ru/ )

• Integrated photonics | Laboratory of Nanophotonics & Metamaterials

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

• Inter-Congress Meetings

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>7) - physcontrol.phys.msu.ru/ )

• List All Categories

Draft Dr. Paul Twomey President and Chief Executive Officer Internet Corporation for Assigned Names and Numbers (ICANN) Speech to Third International Forum Partnership Among State, Business Community and Civil Society in Ensuring Information Security Garmisch-Partenkirchen, Germany Monday, 20 April 2009 Dear Vladislav Petrovich, Dear Alexei Anatolievich, Distinguished guests, Ladies and Gentlemen. ... ICANN itself is evolving, mirroring the changing nature of the global Internet community. ...

Еще в разделе: (Показать все результаты (>18) - iisi.msu.ru/ )

• Институт Проблем Информационной Безопасности

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>5) - www.dubinushka.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>5) - bioinf.fbb.msu.ru/ )

... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

• SINP MSU

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

Еще в разделе: (Показать все результаты (>3) - siberian-lang.srcc.msu.ru/ )

... Language English (en) Русский (ru) . Skip available courses . Управляющий: Алла Леонидовна Назаренко . ... Students will utilize Moodle, an online course management system, as they work to complete the project.љ ... The chief purpose of this courseљљ is to provide you with theoretical insights, practical skills, and ethical standards of the discipline of management with a focus on information management and human resources.љ ... Учитель: Оксана Малютина . ... English Language Courses . ...

Еще в разделе: (Показать все результаты (>10561) - moodle.ffl.msu.ru/ )

The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...

Еще в разделе: (Показать все результаты (>56) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>91) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Geometric methods in optimal control theory | Department: General Problems of

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>72) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/chteniya/f30_vorotyntsev.pdf
• http://www.elch.chem.msu.ru/kuznetsov/temkin.pdf
• http://www.elch.chem.msu.ru/rus/sprav/metals.pdf

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 703 Then the system under study equation): 1 = = 2 3 = takes the following form (we deleted two multipliers from every (F (2 )+ F (3 ))1 (-1+2F (3 ) - 1 2 ), (F (3 )+ F (1 ))2 (-1+2F (1 ) - 2 2 ), (F (1 )+ F (2 ))3 (-1+2F (2 ) - 3 2 ). ... Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 709 function, the system takes the form (4.2). ...

Еще в разделе: (Показать все результаты (>98) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page
• LOCAL TSUNAMI WARNING AND MITIGATION

SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...

Еще в разделе: (Показать все результаты (>11) - mouse.belozersky.msu.ru/ )

• NPG-explorer
• Blocks finder
• PDB entries containing domains of the family "Ribbon-helix-helix protein, copG

... COLAMO [1] . Fire!Constructor [2], . ... Fire!Constructor ( Include COLAMO). ... 4 - Fire!Constructor COLAMO - ARGUS. ... ARGUS : Define N = 5; Define K = 6; Define M = 1; DMC[0.A] # Metka : Read A step M repeat K; Add A, K; Loop N Goto Metka; DMC[0.C] # Metka1 : Read C step M repeat K; Add C, K; Loop N Goto Metka1; DMC[0.D] # Metka2 : Read D step M repeat K; Add D, K; Loop N Goto Metka2; DMC[0.B] # Metka3 : Write B step M repeat K; Add B, K; Loop N Goto Metka3; Read ­ , (.. ...

Еще в разделе: (Показать все результаты (>9) - fpga.parallel.ru/ )

• Терминология