... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... In the commercial world, the business manager (entrepreneur, Chief Executive Officer (CEO), Chief Operating Officer (COO):) must create the infrastructure and face many issues specific to the establishment and development of a new company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>23) - innovation.msu.ru/ )

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>15) - suny.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>2) - composite.msu.ru/ )

Magnetism Department MSU . ... Magnetism department . ... Magnetic Laboratory was created in Moscow State University by professor Vladimir Arkad ev. ... In 1918 Arkad ev returned in MSU where he founded Moscow Magnetic Laboratory, which exists for a long time on the enthusiasm of their members. ... As the head of new department professor Nikolay Akulov was assigned. ... During the period since 1954 till 1987 the head of magnetism division was Eugeny Kondorsky. ... Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>12) - magn.phys.msu.ru/ )

... Shipping Icons . E-Commerce Icons . Building Icons . Hosting Icons . ... But to make your website or interface design a real eye-catcher there was one thing missing: Icons! Icons are an essential tool to simplify user interfaces and today almost every major website uses icons to highlight important parts in their content. ... Visit Website . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>8) - physcontrol.phys.msu.ru/ )

• Widgetkit
• List All Categories

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>16) - www.issp.ac.ru/ )

• Chernogolovka
• Institutes of Chernogolovka
• Comet Ephemerides

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>16) - master.sai.msu.ru/ )

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>143) - ffl.msu.ru/ )

• About Us
• Научная жизнь

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>33) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)

... Change password . Please enter the checkword and your new password . Login . Checkword . New password Confirm password . Recover password . ... Please log in. ... Password . ... Forgot password? Password request . Send me checkword . ... E-mail . ... If you cannot remember your password, enter your login or e-mail you have used for registration. A message containing the check word you can use to change the password will be sent to your e-mail. ... One-time password . ...

Еще в разделе: (Показать все результаты (>5) - www.ffl.msu.ru/ )

• Get Password - Факультет иностранных языков
• Authorization - Факультет иностранных языков

. ASA's collection of pictures useful for WWW-pages creation. ARROWS: 1-91 . BALLS: 1-145 . BUTTONS: 1-156 . ICONS: 1-263 . LINES: 1-174 . PATTERNS: 1-60 . VGIFS: 1-23 . You are since 9 July 1999 at this page. Go to Lab's HomePage . Go to ASA's HomePage .

Еще в разделе: (Показать все результаты (>10) - asa.guru.ru/ )

• People on #C4ACTbE right now
• Alexander Antonov's Resume

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>10) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Alexandr A. Parshintsev

Open Conference Systems . Conference Help . ... Username . Password . Remember me . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . By Title . ... For Authors . Home . ... Log In . Account . Search . Current Conferences . Home > Log In . ... Remember my username and password . ... Create an account with this site . Forgot your password? ...

Еще в разделе: (Показать все результаты (>45) - hea.phys.msu.su/ )

• Account

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>27) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Final program . ...

Еще в разделе: (Показать все результаты (>11) - io.cs.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>41) - lomonosov.sinp.msu.ru/ )

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>4) - margaret.imec.msu.ru/ )

• teachers

... News . ... Create new account (active tab) . ... Request new password . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 пЕпѕпґ) 219 (2016 пЕпѕпґ) 217 (2015 пЕпѕпґ) 215 (2015 пЕпѕпґ) 217 (2014 пЕпѕпґ) 215 (2014 пЕпѕпґ) 315 316 219 218 117 CAPTCHA . ...

Еще в разделе: (Показать все результаты (>206) - nanolab.phys.msu.ru/ )

• Contact khan | Laboratory of Nanophotonics & Metamaterials
• Contact khokhlova | Laboratory of Nanophotonics & Metamaterials
• Teaching | Laboratory of Nanophotonics & Metamaterials

... November 9, 1999 . Spiral Galaxies in Collision . ... the Hubble Heritage Team ( AURA / STScI / NASA ) . ... Until then, spiral galaxies NGC 2207 and IC 2163 will slowly pull each other apart, creating tides of matter, sheets of shocked gas , lanes of dark dust , bursts of star formation , and streams of cast-away stars . Astronomers predict that NGC 2207, the larger galaxy on the left, will eventually incorporate IC 2163, the smaller galaxy on the right. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>26) - www.arcetri.astro.it/ )

• APOD: April 9, 1999 - WR 104: Pinwheel Star