... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

() .., . . , .. (email: fomas2003@list.ru) , , , , , , , , , (), Migration, Deviation , adaptation, the Chinese migrants, criminalisation, victimition, China, Siberia, the Far East, Republic Sakha (Yakutia) . , . The article contains the results of research of migration of Chinas citizent to Yakutia. On a basis of the deviantological analysis of behavioural patterns and features of adaptation of the Chinese are revealed social problems generated by migratory processes in the region.

Еще в разделе: (Показать все результаты (>9) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/3/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/4/10.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/1/14.pdf

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>31) - www.geol.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Immobilized bimetallic clusters: sensors and catalysts of new generation . ... It has been shown that the catalytic clusters increases the sensor signal magnitude and reduce an operating temperature of the semiconductor sensor. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>5) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and

Countless possibilities Goldman Sachs Internship Presentation Venue: Swissotel Krasnye Holmy, Moscow Date and Time: 15 November 20 07, 18:30 Goldman Sachs has been at the forefront of innovation, performance and service in the investment banking, securities and investment management industry since 1869. ... We would like to invite you to attend our company presentation and find out more about our firm and our internship programmes through an evening of presentations and networking opportunities. ...

Еще в разделе: (Показать все результаты (>16) - www.msu.ru/ )

• http://www.msu.ru/work/2008/Morgan.doc

. Поиск . Сделайте nature.web.ru своей стартовой страницей ... Домашняя страница: http://www.jabat.narod.ru . Организация: . http://www.gabro.boom.ru . Грузия, Тбилиси . Диди Дигоми 3 мкр 3 корн кв 126 . Gabro Group Generation . Вход для пользователей . Публикации на сервере . 27.12.2001 Цетриоль . Copyright 2000-2015, РОО "Мир Науки и Культуры". ISSN 1684-9876 .

Еще в разделе: (Показать все результаты (>73) - www.nature.web.ru/ )

• "Введение в криптографию" под редакцией В.В.Ященко
• Беталактамные соединения. Взаимосвязь структуры и биологической активности
• Заключительные этапы эволюции магм Ключевского вулкана (Камчатка) по данным

... Up: Человек против Бога Previous: 3. ... Человек против Бога . This document was generated using the LaTeX 2 HTML translator Version 96.1 (Feb 5, 1996) Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. ... The translation was initiated by Lipunov V.M. on Sat Jan 9 14:41:03 MSK 1999 . Lipunov V.M. Sat Jan 9 14:41:03 MSK 1999 . Copyright (c) "Русский переплет" . ...

Еще в разделе: (Показать все результаты (>10) - www.pereplet.ru/ )

... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...

Еще в разделе: (Показать все результаты (>3) - iconolat13.phys.msu.ru/ )

• Symposia
• Invited speakers

Nuclear Instruments and Methods in Physics Research B 206 (2003) 902­906 www.elsevier.com/locate/nimb Generation of the large current cluster ion beam T. Seki a c a,b,* , J. Matsuo a, G.H. Takaoka a, I. Yamada b,c Ion Beam Engineering Experimental Laboratory, Kyoto University, Sakyo, Kyoto 606-8501, Japan b Collaborative Research Center for Cluster Ion ... The intensity of neutral cluster beam increased with source gas pressure. ... The beam current increased with source gas pressure. ...

Еще в разделе: (Показать все результаты (>40) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_455_1maclasterionSource.pdf

Клуб выпускников МГУ (Московский Государственный Университет) . ... Информация для тех, кто собрался присоединиться к встрече выпускников МГУ в Торонто, 12 июля (воскресенье). Встреча начинается в 15:00 с дегустации свежесваренного пива на пивоварне Steam Whistle ( http://www.steamwhistle.ca/ contact/directory.php - это буквально в 200 метрах от Union Station). ... Телефоны для связи - (416)368-3229, (416)9399007 (cell). ... Страница сайта http://www.moscowuniversityclub.ru . ...

Еще в разделе: (Показать все результаты (>155) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Клетки кожи стали клетками мозга в один ход
• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: Неожиданная взаимосвязь между воспалением и способностью

... Superoxide dismutase (SOD, EC 1.15.1.1) and catalase (CAT, EC 1.11.1.6) together with low-molecular mass antioxidants act as the main defense against ROS produced in various parts of plant cells. ... For investigation of enzyme (SOD, CAT and PAL) activity were used 17 day leaves of controlled and treatment plants. ... ilshat.rafkatovitch@gmail.com - in vitro , 302 . ... H2O2 , H2O2 , H2O2 . ... H2O2- , , . ... 307 Tribulus terrestris L. , .., , , handy_89@mail.ru in vitro . ... PepP Synechocystis sp...

Еще в разделе: (Показать все результаты (>4) - plantphys.bio.msu.ru/ )

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>7) - pont2008.cmc.msu.ru/ )

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>17) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf
• http://dfgm.math.msu.su/files/papers-sym/remark%20on%20nonsymmetric%20compact%20surfaces.pdf

PTOLEMY'S FAILINGS . ... The Crime of Claudius Ptolemy. ... Almost as a stocktaking of Ptolemy , the 1970s saw the publication of three monographic writings on his astronomy , viz, O. Neugebauer's authoritative account of the contents of the Almagest in its context of the mathematical side of the rest of ancient astronomy , 1 O. Pedersen's Almagest companion volume designed to guide also the student of Latin astronomy up to the Renaissance, 2 and R. R. Newton's ...

Еще в разделе: (Показать все результаты (>35) - hbar.phys.msu.ru/ )

Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

... Ph.D., Interregional Public Organization Women in Science and Education ; Faculty of Biology, Lomonosov Moscow State University. ... Social cohesion and unity of the Russian state provides multilateral cooperation and dialogue. The development of the dialogue encourages wide public discussion of a new paradigm of education, the generation of the new ideas to find solutions that promote moral consolidation of the Russian society. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>11) - ee-journal.spa.msu.ru/ )

... Решение задачи безусловной минимизации диффеpенциpуемой функции в n - меpном евклидовом пространстве квазиньютоновским методом. ... R.Bass, A Rank Two Algorithm for Unconstrained Minimisation, Math. of Computation, 1972, v.26, N 117. int mnr1r_c (real *x1, real *xe, integer *i0, integer *n, S_fp func, real *f, real *fe, S_fp grad, real *g, real *ge, real *up, real *rm, integer *w) . ... имя подпрограммы, вычисляющей значение функции; . ... целая переменная, указывающая пpичину окончания счета: . ...

Еще в разделе: (Показать все результаты (>134) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. IA80R_C. Аппроксимация рациональными функциями (равномерная)
• БЧА НИВЦ МГУ. MNA4R_C. Задача минимизации функции одной переменной
• БЧА НИВЦ МГУ. QSE1R_C. Вычисление интегралов специального вида

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>2) - psyberlink.flogiston.ru/ )

... О факультете . ... 6 октября, 15.30 . ... Slow-wave sleep is characterized by a slow oscillation (<1 Hz) that appears as an alternation of active (UP) and silent (DOWN) states. Synchronous neuronal activity during slow oscillation generates EEG slow waves. ... Does thalamus play a role in the generation of slow waves? Do human and animal brains generate slow waves in the same way? ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ . ... 2016 Биологический факультет . ...

180. http://www.parallel.ru/sites/default/files/ftp/cluster/intel-8.0/for_qopl.pdf