. Факультет журналистики МГУ имени М.В. Ломоносова. 125009 Москва, улица Моховая, дом 9, +7 (495) 629-74-35, referent@smi.msu.ru . Материал (C) Факультет журналистики МГУ им. М.В. Ломоносова, 2012 год. Оригинал материала - http://www.journ.msu.ru/study/support/?print=Y
... The Institute is staffed wit h a team of 15 experts involving 6 Ph.D programs including ap plied mathematics, theor etical ph ysics, technolog y for computer applications, signal and information processing and bi ochemical, collab orating wit h experts in p hysiolog y, biolog y, iatrolog y, etc. and sp eci all y engaged in t he research of Human Brain Project and neuro- infor matics. ... Chinese Ph ysics , Jovrnal of Optics, Chinese Ph ysics Letter. ...
... March, 2006 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! March, 26 2006 Entrants of all faculties are invited to a meeting with a management of the University, deans of faculties. (more.. ... This new program is for those who wants to learn Moscow better! ... Bearing a long history inspired by modern spirit, a Russian Culture Festival will be held in Beijing in March. (more.. ...
pic] ADDRESS of the Council of Russian Rectors' Union to scientific-educational community of Russia "INTELLECTUAL POTENTIAL of INNOVATIVE RUSSIA" November 20, 2007 Fundamental science and education play the priority role in forming of innovative economy and intellect-based society. ... We must work in even more active and unified way to create and develop Russian education and Russian science! ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... О факультете . ... The Second White Sea Molecular Zoology Summer School . ... N.A.Pertzov White Sea Biological Station (WSBS MSU) invites undergraduate and graduate students studying zoology and ecology to participate in summer field school on Molecular Zoology, which will take place in September 5-19, 2010. ... Overview of major groups of invertebrates inhabiting the White Sea, determination of species with taxonomic keys, primer on zoological drawings. ... Биологический факультет МГУ . ...
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...
... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...
[
Текст
]
Ссылки http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf -- 1021.6 Кб -- 18.11.2013 Похожие документы
... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...
... Publications . Journals . ... Ivanov A. P. , Erdakova N. N. On a mechanical lens . ... Abstract pdf (548.99 Kb) . In this paper, we consider the dynamics of a heavy homogeneous ball moving under the influence of dry friction on a fixed horizontal plane. ... pdf (548.99 Kb) Journal Info . ... http://mipt.ru/science/trudy/ . ... Ivanov A. P. , Shuvalov N. D. , Ivanova T. B. On detachment conditions of a top on an absolutely rough support . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
Journal of Magnetism and Magnetic Materials 383 (2015) 110 113 Contents lists available at ScienceDirect Journal of Magnetism and Magnetic Materials journal h ome p age : www. e ls evier.c o m/locate/jmmm Transverse magneto-optical Kerr effect in 2D gold garnet nanogratings A.V . Chetvertukhin a, A.I. Musorin a, T.V. Dolgova a, H. Uchida b, M. Inoue c, ... Large Q-factor of the resonance is attributed to the localisation of optical fields in the magnetic garnet film. ...