... Company Presentation, Workshops & Evening Reception Wednesday 30th September 2009, 14:30 - 19:30 Sheraton Palace Hotel Moscow, Rooms St.Petersburg 1-2 The presentation will give you an insight in our business model, our culture. Workshops will provide you with information on how to apply for full-time positions and internships. ... To register for the event, please apply online at www.barcap.com/expectexcellence and select "Moscow" as the location in your application. ...

Еще в разделе: (Показать все результаты (>67) - www.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GEOLOGY%20GEOCRYOLOGY.pdf
• Faculty of Geology

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>16) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2011_tsunami%20vs%20eq.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2009%20Bromm%20et%20al.%2C%20The%20formation%20of%20the%20first%20stars%20and%20galaxies.pdf

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>7) - hep.phys.msu.ru/ )

1, 120103 (2012) . ... 2012 120103-1 1, 120103 (2012) . ... xi ,yk ) : i,k =- 3 ( hy 2 i,k-1 - i,k 1 )- 2 i,k-1 . ... 2 2 + 2 i,k = hx2 hy i-1,k +i+1 = hx2 ,k + i,k-1 + hy 2 i,k+1 + i,k . ... 1, 120103 (2012) max 2, max -- ; -- . ... 2012 120103-8 1, 120103 (2012) Numerical mo delling of propagation pro cess and sedimentation of ablated particles in the scheme of a direct laser dusting . ... 492) 247-96-21, e-mail: aantipov@vlsu.ru. 2. -- .-. , ; .: (492) 253-33-58 e-mail: aarak@vlsu.ru. 3. -- ; . ...

Еще в разделе: (Показать все результаты (>2) - uzmu.phys.msu.ru/ )

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>2) - np-chair.sinp.msu.ru/ )

... The Sixth International Conference «Scientific Issues in Security and Combating Terrorism », Moscow, 11 - 12th of November, 2010 The Council of Europe approach to the international information security in the context of the fight against terrorism Ms. Marta Requena, Head of the Public International Law and Anti- Terrorism Division Head of the Counter Terrorism Task Force, Council of ... States certainly remain the principle actors of the fight against terrorism. ...

Еще в разделе: (Показать все результаты (>4) - www.iisi.msu.ru/ )

... The study of adaptive variability, i.e. the study on the population level of the physiological adaptation of the human organism to a variety of environmental conditions, is the main purpose and the basic principle of physiological anthropology. ... Regional rates of hormonal activity of indigenous population of different ethno-territorial groups that we have elaborated broaden our notions about common conformities of age variability and aging and the reasons of these processes. ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Krejnes, M. A., Morozova E. A., Chentsov, N. N. XIII Moscow School Mathematical Olympiad. Uspekhi Mat. Nauk 5 (1950), No. 5 (in Russian). ... Congress 2 (1956) (in Russian). ... Mat. ... Morozova, E.A., Petrakov, I. S. International Mathematical Olympiad (completed 2-nd publication). ... Morozova, E.A., Petrakov, I. S., Sevorcov, V. A. International Mathematical Olympiad (completed 4-nd publication). ... Morozova, E. A., Chentsov, N. N. Matrices of probabilities and stochastic supermatrices. ...

Еще в разделе: (Показать все результаты (>116) - higeom.math.msu.su/ )

• Topology section

. [ Войти ] . Главная -> Фильмы -> The Illustrated Family Doctor . Пользователи . Демо . Деньги . Фильмы . Форум . The Illustrated Family Doctor . Австралия 2005 . отметить . Комедия . Триллер . Драма .

Еще в разделе: (Показать все результаты (>47) - kinfo.ru/ )

• The Illustrated Mum - Фильмы - Kinfo.ru
• Final Approach - Фильмы - Kinfo.ru
• Moving Illustrations of Mach.. - Фильмы - Kinfo.ru

Fluctuation in EAS development and estimates of energy and composition of the primary radiation by L. Dedenko, SINP, MSU 1) surface scintillation detectors (SD) 2) detectors of the Vavilov-Cherenkov radiation (VCR) 3) underground detectors of muons (UD) (with the threshold energy ~1 GeV). Yakutsk array Detectors readings · The various particles · of Extensive Air Showers (EAS) · at the observation level · hit detectors · and induce some signals sampled as · detector readings 18.05.2011. IWS. ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...

Еще в разделе: (Показать все результаты (>2) - www.universe.msu.ru/ )

... In my opinion, it became the landmark for Russian education. ... This means academic mobility, joint scientific research, joint development of new forms of evaluation of the quality of education, including new mechanisms of the global rating of institutions of higher education. All this will contribute to prevention of the current trend to breakage of ties between the key subjects of the educational process: students' and teachers' corporations, employers, state and social institutes. ...

Еще в разделе: (Показать все результаты (>25) - www.rsr-online.ru/ )

... XXXI Конгресс Международной ассоциации гидрогелогов "New Approaches to Characterising Groundwater Flow" . ... XXXI Конгресс Международной ассоциации гидрогелогов "New Approaches to Characterising Groundwater Flow" будет проходить 10 сентября 2001 года в Германии, Мюнхен. ...

Еще в разделе: (Показать все результаты (>258) - www.nature.web.ru/ )

• Поведенческие реакции рыб на болевые стимулы

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>5) - asa.guru.ru/ )

• Alexander Antonov's Resume

... Head of the laboratory of amorphous and crystalline alloys of rare earth metals. ... Physics of magnetics, magnetic phase transitions, magnetic properties of rare earth compounds. ... Experimental study of the magnetic properties of rare earth alloys and compounds. ... Three-critical point on magnetic phase diagram was found in dysprosium and rare earth alloys. ... Giant magnetocaloric effect has been found in rare earth metals, Fe-Rh alloy and a series of intermetallic compounds. ...

Еще в разделе: (Показать все результаты (>23) - ferro.phys.msu.ru/ )

• Special courses for the students of Physics Faculty, specialized at the...

Optical imaging of fluorescent carbon biomarkers using artificial neural networks Tatiana A. Dolenko Sergey A. Burikov Alexey M. Vervald Igor I. Vlasov Sergey A. Dolenko Kirill A. Laptinskiy Jessica M. Rosenholm Olga A. Shenderova Downloaded From: http://biomedicaloptics.spiedigitallibrary.org/ on 12/17/ 2014 Terms of Use: http://spiedl.org/terms Journal of Biomedical Optics 19(11), 117007 (November 2014 ) Optical imaging of fluorescent ... Results of Using Artificial Neural Networks Fig. ...

Еще в разделе: (Показать все результаты (>24) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/Assets/Water/ResLet2008.pdf
• http://rswater.phys.msu.ru/Assets/Water/PatRec2007.pdf
• http://rswater.phys.msu.ru/Assets/Water/LasPhys2005.pdf

Bifurcations of Equilibria in Potential Systems at Bimodal Critical Points Alexei A. Mailybaev e-mail: mailybaev@imec.msu.ru Alexander P. Seyranian e-mail: seyran@imec.msu.ru Institute of Mechanics, Moscow State Lomonosov University, Michurinsky prospect 1, 119192 Moscow, Russia Bifurcations of equilibria at bimodal branching points in potential systems are investigated. ... In this paper, we intend to give a complete theory of bimodal bifurcations in potential systems with symmetries. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/KliemEtAl2006.pdf
• Multiparameter Stability Theory with Mechanical Applications

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. November 11, 1997 . The Annotated Galactic Center . ... Constellations of nearby stars include Sagittarius , Libra , Scorpius , Scutum , and Ophiuchus . ... Open clusters include M6 , M7 , M18 , M21 , M23 , M24 , M25 . Globular clusters include M9 , M22 , M28 , M54 , M69 , M70 . ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>23) - www.arcetri.astro.it/ )