... use of several physical disks to run each PC GAMESS/Firefly process so that each copy uses only its own HDD. ... The LAM/MPI version 7.1.X. Note that the PC GAMESS/Firefly is not compatible with older LAM/MPI versions e.g., 6.5.9. ... Please consult with the LAM/MPI documentation and manual pages before start experimenting with parallel PC GAMESS/Firefly runs. The LAM/MPI-linked PC GAMESS/Firefly binaries should present on all the computers you plan to run the PC GAMESS/Firefly in parallel . ...

Еще в разделе: (Показать все результаты (>109) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel Linux/MPICH binaries
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using

... intas:cern-intas03:task5 ]] . THEP . ... T5.MS Windows.. ... The use of the Windows platform for LCG tasks . ... Porting some of the LCG software on the MS Windows .NET platform . ... Study of the VMware as a software for emulation of multi-computer clusters for the LCG purposes. ... Building of Linux computations clusters on a top of Windows computers (under VMware) would be a great benefit for the Russian Tier2 by obtaining an additional power for distributed computations in a batch mode. ...

Еще в разделе: (Показать все результаты (>32892) - theory.sinp.msu.ru/ )

• [Computer_algebra] [Fwd: [Fwd: New Version of REDUCE]]
• fc3:dokuwiki:example [THEP]
• fcp:rest:taskschema [THEP]

... MySQL shareware license for Microsoft operating systems (Version 1, September 4, 1998) . ... This License applies when running MySQL on any Microsoft operating system. Microsoft operating systems include all versions of Microsoft Windows NT and Microsoft Windows. ... E-Mail: mysql-licensing@mysql.com For more about the license prices and commercial support, like email support, please refer to the MySQL manual. ... Our current policy is that a user with the MySQL license can get free upgrades. ...

Еще в разделе: (Показать все результаты (>880) - itpm.msu.su/ )

• htpasswd - Manage user files for basic authentication - Apache HTTP Server
• mod_charset_lite - Apache HTTP Server
• dbmmanage - Manage user authentication files in DBM format - Apache HTTP Server

... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 > Modules . Description: . ... version_module . ... This module is designed for the use in test suites and large networks which have to deal with different httpd versions and different configurations. It provides a new container -- <IfVersion> , which allows a flexible version checking including numeric comparisons and regular expressions. IfVersion 2.1.0> . ... IfVersion [[!] operator ] version > .. ...

Еще в разделе: (Показать все результаты (>1306) - uneex.lorien.cs.msu.su/ )

• They're Nearly Identical?
• htpasswd - Manage user files for basic authentication - Apache HTTP Server
• mod_charset_lite - Apache HTTP Server

NAME dbmmanage - Create and update user authentication files in DBM format SYNOPSIS dbmmanage filename [ command ] [ username [ encpasswd ] ] DESCRIPTION dbmmanage is used to create and update the DBM format files used to store usernames and password for basic authentica- tion of HTTP users. Resources available from the httpd Apache web server can be restricted to just the users listed in the files created by dbmmanage. ... This manual page only lists the command line arguments. ...

Еще в разделе: (Показать все результаты (>132) - neptun.sai.msu.ru/ )

• Apache HTTP Server: Notes about Compatibility with NCSA's Server
• Apache Server Virtual Host Support
• Manual Page: htpasswd - Apache HTTP Server

Электронная библиотека Попечительского совета . ... Begmatov A.K. - A Certain Inversion Problem for the Ray Transform with Incomplete Data . ... Название: A Certain Inversion Problem for the Ray Transform with Incomplete Data . Автор: Begmatov A.K. Аннотация: . The problem is considered of reconstructing a function in three-dimensional space from its integrals over a family of straight lines that are generators of cones, i.e., an inversion problem for the ray transform with incomplete data. ...

Еще в разделе: (Показать все результаты (>29914) - lib.mexmat.ru/ )

• Hearn D., Baker M.P. - Computer Graphics, C Version :: Электронная библиотека
• Brent R.P., Zimmermann P. - Modern computer arithmetic. Version 0.5.3 of 1
• Reverse engineering in computer applications :: Электронная библиотека

HASAS . HASAS (HydroAcoustic Signal Analysis System) is a modular system for passive sonar signal analysis. ... Home Site: . ... See Home Site for details . ... None . ... SAL Home | Computer Graphics, Images Signals | Processing Visualization . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>11925) - www.sai.msu.su/ )

• SAL- Computer Graphics, Images Signals - Modelers - Font3D
• Zen: sncat design
• SAL- Parallel Computing - Tools Utilities - ScaLAPACK

A descriptor , also commonly called a file handle is an object that a program uses to read or write an open file, or open network socket, or a variety of other devices. ... The operating system enforces a limit on the number of descriptors that a program can have open at a time. ... The second limit is called the hard resource limit, and it is sometimes set by root in an obscure operating system file, but frequently is the same as the kernel limit. ... BSDI 2.0 . ... FreeBSD 2.2, BSDI 2.1+ . ...

Еще в разделе: (Показать все результаты (>1096) - rtm-cs.sinp.msu.ru/ )

• Issues Regarding DNS and Apache
• Linux ADSM Mini-Howto
• Linux on Sony VAIO mini-HOWTO

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>81) - old.philol.msu.ru/ )

See Also: IP-based Virtual Host Support . Early versions of HTTP (like many other protocols, e.g. FTP) required a different IP address for each virtual host on the server. ... The benefits of using the name-based virtual hosts is a practically unlimited number of servers, ease of configuration and use, and it requires no additional hardware or software. ... For example, suppose that both www.domain.tld and www.otherdomain.tld point at the IP address 111.22.33.44 . ...

Еще в разделе: (Показать все результаты (>1184) - oit.cmc.msu.ru/ )

• Apache HTTP Server: Security Tips
• Hints on Running a High-Performance Web Server
• Descriptors and Apache

... The two common precisions single precision (SP) and double precision (DP) on a system based on IEEE 754 can specified with INTEGER , PARAMETER :: SP = SELECTED_ REAL _ KIND (6,37) INTEGER , PARAMETER :: DP = SELECTED_ REAL _ KIND (15,307) REAL ( KIND =SP) :: single_ precision _variables REAL ( KIND =DP) :: double _ precision _variables If we wish to work with at least 14 decimal ...

Еще в разделе: (Показать все результаты (>7697) - crydee.sai.msu.ru/ )

• Tutorial on Fortran 90, PC version
• Use of program libraries
• NAG's Fortran 90

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . development of the Automatic solver of mathematical problems . ... Search in Databases . ... Here is a lecture notes in Russian by A.S. Podkolzin " Computer modeling by mathematical problems solving ". ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>172) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Research :: Computer Teacher
• Intelligent Systems :: Research

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>8) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

... trac . ... You can get a comprehensive list of the available options, commands and sub-commands by invoking `trac-admin` with the `help` command:. €а . ... The only exception is for the `help` command, but even in this case if you omit the environment, you'll only get a very succinct list of commands (`help` and `initenv`), the same list you'd get when invoking `trac-admin` alone. €а . ... Also, `trac-admin --version` will tell you about the Trac version (e.g. 0.12) corresponding to the program. €а ...

Еще в разделе: (Показать все результаты (>3551) - kodomo.cmm.msu.ru/ )

• TracWorkflow (diff) тАУ Tanchiki
• TracModWSGI тАУ Tanchiki
• WikiProcessors тАУ Tanchiki

Application of the Lagrange principle in the problem of optimal inversion of linear operators in the case of sourcewise representability of the exact solutions to operator equations" . Bayev A.V. The problem of approximate solution of a linear operator equation with a priori information on its solution is studied. A problem whose exact solution belongs to a ball image is considered when a linear continuous operator is used for mapping. ...

Еще в разделе: (Показать все результаты (>730) - num-meth.srcc.msu.ru/ )

• Regularized inversion of full tensor magnetic gradient data
• "Nonlinear least-squares full waveform inversion: SVD analysis"
• Contents.Volume 8

... Science . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich engineer, Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich professor, Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>787) - ofvp.phys.msu.ru/ )

• Laboratory of theoretical problems in optics

There are two main versions of UNIX in use today: System V and BSD . ... From a user's perspective they are very similar and you are unlikely to have difficulty unless you use more than one type of system. In this case you might notice differences in the structure of the file system or in how certain commands behave. ... Although UNIXhelp is now based on a System V variant of UNIX, you should see only minor differences in the example input and output if your system is a BSD one. ...

Еще в разделе: (Показать все результаты (>850) - comet.sai.msu.ru/ )

• Examples of comparing files with the sccsdiff command
• Comparing files under SCCS control
• Understanding HTML and MIME

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>92) - www.socio.msu.ru/ )